Poster un nouveau message
En réponse à :
Une banque de séquences au format FASTA
par Laurent Bloch
le mardi 12 octobre 2021

C’est une petite banque de séquences extraites de génomes d’orchidées :
>gi|2765658|emb|Z78533.1|CIZ78533 C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG AATCCGGAGGACCGGTGTACTCAGCTCACCGGGGGCATTGCTCCCGTGGTGACCCTGATTTGTTGTTGGG CCGCCTCGGGAGCGTCCATGGCGGGTTTGAACCTCTAGCCCGGCGCAGTTTGGGCGCCAAGCCATATGAA AGCATCACCGGCGAATGGCATTGTCTTCCCCAAAACCCGGAGCGGCGGCGTGCTGTCGCGTGCCCAATGA (...)

modération a priori

Ce forum est modéré a priori : votre contribution n’apparaîtra qu’après avoir été validée par un administrateur du site.

Qui êtes-vous ?
Votre message

Pour créer des paragraphes, laissez simplement des lignes vides.

Lien hypertexte

(Si votre message se réfère à un article publié sur le Web, ou à une page fournissant plus d’informations, vous pouvez indiquer ci-après le titre de la page et son adresse.)