| |
Site WWW de Laurent Bloch
Slogan du site

ISSN 2271-3905
Cliquez ici si vous voulez visiter mon autre site, orienté vers des sujets moins techniques.

Pour recevoir (au plus une fois par semaine) les nouveautés de ce site, indiquez ici votre adresse électronique :

Une banque de séquences au format FASTA
Article mis en ligne le 12 octobre 2021

par Laurent Bloch

C’est une petite banque de séquences extraites de génomes d’orchidées :

  1. >gi|2765658|emb|Z78533.1|CIZ78533 C.irapeanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  2. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG
  3. AATCCGGAGGACCGGTGTACTCAGCTCACCGGGGGCATTGCTCCCGTGGTGACCCTGATTTGTTGTTGGG
  4. CCGCCTCGGGAGCGTCCATGGCGGGTTTGAACCTCTAGCCCGGCGCAGTTTGGGCGCCAAGCCATATGAA
  5. AGCATCACCGGCGAATGGCATTGTCTTCCCCAAAACCCGGAGCGGCGGCGTGCTGTCGCGTGCCCAATGA
  6. ATTTTGATGACTCTCGCAAACGGGAATCTTGGCTCTTTGCATCGGATGGAAGGACGCAGCGAAATGCGAT
  7. AAGTGGTGTGAATTGCAAGATCCCGTGAACCATCGAGTCTTTTGAACGCAAGTTGCGCCCGAGGCCATCA
  8. GGCTAAGGGCACGCCTGCTTGGGCGTCGCGCTTCGTCTCTCTCCTGCCAATGCTTGCCCGGCATACAGCC
  9. AGGCCGGCGTGGTGCGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGCGGCGGGTCCAAGAGCTGGTGT
  10. TTTGATGGCCCGGAACCCGGCAAGAGGTGGACGGATGCTGGCAGCAGCTGCCGTGCGAATCCCCCATGTT
  11. GTCGTGCTTGTCGGACAGGCAGGAGAACCCTTCCGAACCCCAATGGAGGGCGGTTGACCGCCATTCGGAT
  12. GTGACCCCAGGTCAGGCGGGGGCACCCGCTGAGTTTACGC
  13.  
  14. >gi|2765657|emb|Z78532.1|CCZ78532 C.californicum 5.8S rRNA gene and ITS1 and ITS2 DNA
  15. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAACAGAATATATGATCGAGTG
  16. AATCTGGAGGACCTGTGGTAACTCAGCTCGTCGTGGCACTGCTTTTGTCGTGACCCTGCTTTGTTGTTGG
  17. GCCTCCTCAAGAGCTTTCATGGCAGGTTTGAACTTTAGTACGGTGCAGTTTGCGCCAAGTCATATAAAGC
  18. ATCACTGATGAATGACATTATTGTCAGAAAAAATCAGAGGGGCAGTATGCTACTGAGCATGCCAGTGAAT
  19. TTTTATGACTCTCGCAACGGATATCTTGGCTCTAACATCGATGAAGAACGCAGCTAAATGCGATAAGTGG
  20. TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTCGAGGCCATCAGGCTAAG
  21. GGCACGCCTGCCTGGGCGTCGTGTGTTGCGTCTCTCCTACCAATGCTTGCTTGGCATATCGCTAAGCTGG
  22. CATTATACGGATGTGAATGATTGGCCCCTTGTGCCTAGGTGCGGTGGGTCTAAGGATTGTTGCTTTGATG
  23. GGTAGGAATGTGGCACGAGGTGGAGAATGCTAACAGTCATAAGGCTGCTATTTGAATCCCCCATGTTGTT
  24. GTATTTTTTCGAACCTACACAAGAACCTAATTGAACCCCAATGGAGCTAAAATAACCATTGGGCAGTTGA
  25. TTTCCATTCAGATGCGACCCCAGGTCAGGCGGGGCCACCCGCTGAGTTGAGGC
  26.  
  27. >gi|2765656|emb|Z78531.1|CFZ78531 C.fasciculatum 5.8S rRNA gene and ITS1 and ITS2 DNA
  28. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGCAGAACATACGATCGAGTG
  29. AATCCGGAGGACCCGTGGTTACACGGCTCACCGTGGCTTTGCTCTCGTGGTGAACCCGGTTTGCGACCGG
  30. GCCGCCTCGGGAACTTTCATGGCGGGTTTGAACGTCTAGCGCGGCGCAGTTTGCGCCAAGTCATATGGAG
  31. CGTCACCGATGGATGGCATTTTTGTCAAGAAAAACTCGGAGGGGCGGCGTCTGTTGCGCGTGCCAATGAA
  32. TTTATGACGACTCTCGGCAACGGGATATCTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAG
  33. TGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCT
  34. AAGGGCACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTGATAATGCTTGATTGGCATGCGGCTAGTC
  35. TGTCATTGTGAGGACGTGAAAGATTGGCCCCTTGCGCCTAGGTGCGGCGGGTCTAAGCATCGGTGTTCTG
  36. ATGGCCCGGAACTTGGCAGTAGGTGGAGGATGCTGGCAGCCGCAAGGCTGCCGTTCGAATCCCCCGTGTT
  37. GTCGTACTCGTCAGGCCTACAGAAGAACCTGTTTGAACCCCCAGTGGACGCAAAACCGCCCTCGGGCGGT
  38. GATTTCCATTCAGATGCGACCCCAGTCAGGCGGGCCACCCGTGAGTAA
  39.  
  40. >gi|2765655|emb|Z78530.1|CMZ78530 C.margaritaceum 5.8S rRNA gene and ITS1 and ITS2 DNA
  41. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAAACAACATAATAAACGATTGAGTG
  42. AATCTGGAGGACTTGTGGTAATTTGGCTCGCTAGGGATATCCTTTTGTGGTGACCATGATTTGTCATTGG
  43. GCCTCATTGAGAGCTTTCATGGCGGGTTTGAACCTCTAGCACGGTCCAGTTTGCACCAAGGTATATAAAG
  44. AATCACCGATGAATGACATTATTGCCCCACACAACGTCGGAGGTGTGGTGTGTTAATGTTCATTCCAATG
  45. AATTTTGATGACTCTCGGCAGACGGATATCTTGACTCTTGCATCGATGAAGAACGCACCGAAATGTGATA
  46. AGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGG
  47. CTAAGGGCACGCCTGCCTGGGCGTCGTATGTTTTATCTCTCCTTCCAATGCTTGTCCAGCATATAGCTAG
  48. GCCATCATTGTGTGGATGTGAAAGATTGGCCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATATGTGTTT
  49. TGATGGTCTGAAACTTGGCAAGAGGTGGAGGATGCTGGCAGCCGCAAGGCTATTGTTTGAATCCCCCATG
  50. TTGTCATGTTTGTTGGGCCTATAGAACAACTTGTTTGGACCCTAATTAAGGCAAAACAATCCTTGGGTGG
  51. TTGATTTCCAATCAGATGCGACCCCAGTCAGGGGGCCACCCCAT
  52.  
  53. >gi|2765654|emb|Z78529.1|CLZ78529 C.lichiangense 5.8S rRNA gene and ITS1 and ITS2 DNA
  54. ACGGCGAGCTGCCGAAGGACATTGTTGAGACAGCAGAATATACGATTGAGTGAATCTGGAGGACTTGTGG
  55. TTATTTGGCTCGCTAGGGATTTCCTTTTGTGGTGACCATGATTTGTCATTGGGCCTCATTGAGAGCTTTC
  56. ATGGCGGGTTTGAACCTCTAGCACGGTGCAGTTTGCACCAAGGTATATAAAGAATCACCGATGAATGACA
  57. TTATTGTCAAAAAAGTCGGAGGTGTGGTGTGTTATTGGTCATGCCAATGAATTGTTGATGACTCTCGCCG
  58. AGGGATATCTTGGCTCTTGCATCGATGAAGAATCCCACCGAAATGTGATAAGTGGTGTGAATTGCAGAAT
  59. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGG
  60. GCGTCGTATGTTTTATCTCTCCTTCCAATGCTTGTCCAGCATATAGCTAGGCCATCATTGTGTGGATGTG
  61. AAAGATTGGCCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATATGTGTTTTGATGGTCTGAAACTTGGCA
  62. AGAGGTGGAGGATGCTGGCAGCCGCAAGGCTATTGTTTGAATCCCCCATGTTGTCATATTTGTTGGGCCT
  63. ATAGAACAACTTGTTTGGACCCTAATTAAGGCAAAACAATCCTTGGGTGGTTGATTTCCAATCAGATGCG
  64. ACCCCAGTCAGCGGGCCACCAGCTGAGCTAAAA
  65.  
  66. >gi|2765652|emb|Z78527.1|CYZ78527 C.yatabeanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  67. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTAGAATATATGATCGAGTG
  68. AATCTGGATGACCTGTGGTTACTCGGCTCGCCTGATTTGTTGTTGGGCTTCCTTAGGAGCTTACATGGCG
  69. GGTTTGAACCTCTACCACGGTGCAGTTTGCGCCAAGTCATATGAAGCATAACTGCAAATGGCACTACTGT
  70. CACCAAAAGTTGGAGTGGCAGTGTGTTATTGCATGCGCTAATGGATTTTTGATGACTCTCGGCCAACGGA
  71. TATCTGGCTCTTTGCATCGATGAAGGAACGCAGCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGC
  72. GAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTC
  73. GTGTATCGCATCTCTCTTGCCAATGCTTACCCGGCATACAACTAGGCTGGCATTGGGTGGATGTGAAAGA
  74. TTGGCCCCTTGTGCCTAGGTGCGGTGGGTCTAAGGATTGATGTTTTGATGGATCGAAACCTGGCAGGAGG
  75. TGGAGGATGCTGGAAGCCGCAAGGCTGTCGTTCGAATCCCCCATGTTGTCATATTTGTCGAACCTATAAA
  76. AGAACATGCTTGAACCCCAATGGATTGTAAAATGACCCTTGGCGGTTGATTTCCATTTAGATGCGACCCC
  77. AGGTCAGGCGGGCCACCC
  78.  
  79. >gi|2765651|emb|Z78526.1|CGZ78526 C.guttatum 5.8S rRNA gene and ITS1 and ITS2 DNA
  80. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTAGAATATATGATCGAGTG
  81. AATCTGGAGGACCTGTGGTTACTCGGCTCCCCTGATTTGTTGTTGGGCTTCCTTAGGAGCTTACATGCCG
  82. GGTTTGAACCTCTACCACGGTGCAGTTTGCGCCAAGTCATATGAAGCATAACTGAACAATGGCATTATTG
  83. TCACCAAAAGTTGGAGTGGCAGTGTGCTATTGCATGCGCTAATGGATTTTTGATGACTCTCGCCAACGGA
  84. TATCTTGGCTCTTGCATCGATGAAGAACCCAGCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGCG
  85. AACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCG
  86. TGTATCGCATCTCTCTTGCCAATGCTTACCCGGCATACAACTAGGCTGGCATTGTGCGGATGTGAAAGAT
  87. TGGCCCCTTGTGCCTAGGTGCGGTGGGTCTAAGGATTGATGTTTTGATGGATCGAAACCTGGCAGGAGGT
  88. GGAGGATGCTGGAAGCCGCAAGGCTGTCGTTCGAATCCCCCATGTTGTCATATTTGTCGAACCTATAAAA
  89. GAACATGCTTGAACCCCAATGGATGTAAAATGACCCTTGGCGGTTGATTTCCATTTAGATGCGACCCCAG
  90. GTCAGGCGGGGCCACCCGCTGAGTTTATGT
  91.  
  92. >gi|2765650|emb|Z78525.1|CAZ78525 C.acaule 5.8S rRNA gene and ITS1 and ITS2 DNA
  93. TGTTGAGATAGCAGAATATACATCGAGTGAATCCGGAGGACCTGTGGTTATTCGGCTTGCCGAGGGCTTT
  94. GCTTTTGTGGTGACCCAAATTTGTCGTTGGGCCTCCTCGGGAGCTTTCATGGCAGGTTTCAAACTCTAGC
  95. ACGGCACAGTTTGTGCCAAGTCATATGAAGCATCACCGACAAATGACATTATTGTCAAAAAAGTTGGAGG
  96. GGCGGTGTCCTCCTGTGCATGCCGAATATAATTTTGATGACTCTCGACAAGCGGATATCTTGGCTCTTGC
  97. ATCGGATGAAGAACCCAGCGAAATGCGATAAGTGGTGTGAATTGCAAGATCCCGTGAACCATCGAGTCTT
  98. TTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGTGTTGTGTCTC
  99. TCTTGCCAATGCCTGTCCATATATCTAGGCTTGCATTGTGCGGATGCGAAAGATTGGCCCCTTGTGCCTT
  100. GGCGCGTTGGGTCTAAGGAATGTTTTGATGGCCCGAAACTTGGCAGGAGGTGGAGGACATTGGCTGCCAC
  101. AAGGTTGTCATTTAAATCCCCCATGTTATCGTATTTATCGGACCTATATAATAACTTGTTTGAACCCCAG
  102. TGGAGGCAAAATGACCCTTGGATGGTTGACTGCCATTCATATGCGACCCCAGGTCAGGCGGGCCACCCGC
  103. TGCA
  104.  
  105. >gi|2765649|emb|Z78524.1|CFZ78524 C.formosanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  106. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATAGTAGAATATATGATTGAGTG
  107. AATATGGAGGACATGTGGTTACTTGGCTCGTCAGTGCTTTGCTTTTGTGGTGACCTTAATTGGGCCTCCT
  108. TAGGAGCTTTCATGGCGGGTTCAAACCTTTAGCACGGCGCAGTTTGTGCCAAGTCATATAAGCATCCCTG
  109. ATGAATGGCATTGTTGTTAAAAAAGTCGGAGGGGCGGCATGCTGTTGTGCATGCTAATGAATTTTTTGAT
  110. GACTCTCGCAACGGAACTTGGCTCTTTACATCCGATGAAGAACGCAGCGAAATGCGATAAGTGGTGTGAA
  111. TTGCAGAATCCCGTGAACCATCGAGTATTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCTAAGGGCACG
  112. CCTGCCTGGGCGTCGTGTGCTGCATCTCTCCTNCCAATGCTTGCCCAGCATATAGCTAGGTTAGCATTGT
  113. GCGGATGAAATATTGGCCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATTAGTATTTTGATAGCTCGGAA
  114. CTCGGCAGGAGGTGGAGAATGTTGGTAGCTGCAAGGCTGCCATTTGAATTCCCCATGTTGTCGTATTTGT
  115. TGAACCTATAAAAGAACTTGTTTGAACCCCAATGAAGGAAAAATGACCCTTGGGCGGTTGATTTTCATTC
  116. AGATGCAACCCCAGGTCAGGTGGCCACCCTGAGATTAAGC
  117.  
  118. >gi|2765648|emb|Z78523.1|CHZ78523 C.himalaicum 5.8S rRNA gene and ITS1 and ITS2 DNA
  119. CGTAACCAGGTTTCCGTAGGTGAACCTGCGGCAGGATCATTGTTGAGACAGCAGAATATATGATCGAGTG
  120. AATCCGGTGGACTTGTGGTTACTCAGCTCGACATAGGCTTTGCTTTTGCGGTGACCCTAACTTGTCATTG
  121. GGCCTCCTCCCAAGCTTTCCTTGTGGGTGTGAACCTCTAGCACGGTGCAGTATGCGCCAAGTCATATGAA
  122. GCATCACTGAGGAATGACATTATTGTCCCAAAAGCTAGAGTGGAAGCGTGCTCTTGCATGCATGCATAAT
  123. GAATTTTTTATTGACTCTCGACATATGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAAC
  124. GCAAGTTGCGCCCGATGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTAT
  125. CAATGCTTTCCTATCATATAGATTGGTTTGCATTGCGTGGATGCGAAAGATTGGCCCCTTGTGCCTAGGT
  126. GCGGTGGGTCTAAGGACTAGTGTTTTGATGGTTCGAAACCTGGCAGGAGGTGGAGGATGTTGGCAGCTAT
  127. AAGGCTATCGTTTGAACCCCCCATATTGTCGTGTTTGTCGGACCTAGAGAAGAACCTGTTTGAATCCCAA
  128. TGGAGGCAAACAACCCTCGGGCGGTTGATTGCCATTCATATTGCGACCCAGGTCAGGCGGGGCCACCGCT
  129. GAGTTTAAG
  130.  
  131. >gi|2765647|emb|Z78522.1|CMZ78522 C.macranthum 5.8S rRNA gene and ITS1 and ITS2 DNA
  132. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGCAGAATATATGATCGAGTG
  133. AATCCGGTGGACTTGTGGTTACTCAGCTCGACATAGGCTTTGCTTTTGCGGTGACCCTAATTTGTCATTG
  134. GGCCTCCCCCCAAGCTTTCCTTGTGGGTTTGAACCTCTAGCACGGTGCAGTATGCGCCAAGTCATATGAA
  135. GCATCACTGATGAATGACATTATTGTCCAAAAAGTTGGAGTGGAAGCGTGCTATTGCATACATGCAAATG
  136. AATTTTTTATGACTCTCGACATATCGTGGTGTGATCGCAGAATCCCGTGAACCATCGAGTCTTTGAACGC
  137. AAGTTGCGCCCGATGCCATCAGGCTAAGGGAACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTGTCA
  138. ATGGTTATACGTCATATAGACAGGTTTGCATTGCGTGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGC
  139. GGTGGGTCTAAGGACTAGTGTTTTGATGGTTCGAAACCTGGCAGGAGGTGGAGGATGTTGGCAGCTATAA
  140. GGCTATCATTTGAATCCCCCATATTGTCGTGTTTGTCGGACCTAGAGAAGAACATGTTTGAATCCCAATG
  141. GGGGCAAACAACCCTCGGGCGGTTGATTGCCATTCATATGCGACCCCAGGTCAGGCGGCCACCCGCTGAG
  142.  
  143. >gi|2765646|emb|Z78521.1|CCZ78521 C.calceolus 5.8S rRNA gene and ITS1 and ITS2 DNA
  144. GTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTAGAATATATGATCGAGTGAATCCGGTGGACTTG
  145. TGGTTACTCAGCTCGACATAGGCTTGGCTTTGGCGGTGACCCTAATTTGCCATTGGGCCTCCTCCAAAGC
  146. TTTCCTTGTGGGTTTGAACCTCTAGCACGGTGCAGTATGCGCCAAGTCATATGAAGCATCACCGATGAAT
  147. GACATTATTGTCAAAAAGTTGGAGTGGAAGCGTGCTATTGCATGCATGCAAATGAATTTTTTATGACTCT
  148. CGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCAGCAAAATGCGATAAGTGGTGTGAATTGCA
  149. GAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATCAGGCTAAGGGCACGCCTGC
  150. CTGGGCGTCGTGTGCTGCGTCTCTCCTGTCAATGCTTTCATGTCATATAGATAGGTTTGCATTGCGTGGA
  151. TGTGAAAGAATGGCCCCTTGTGCCTAGGTACGGTGGGTCTAAGGACTAGTGTTTTGATGGTTCGAAACCT
  152. GGCAGGAGGTGGAGGATGTTGGCAGCTATAAGGCTATCATTTGAATCCCCCATATTGTCGTGTTTGTCGG
  153. ACCTAGAGAAAAACATGTTTGAATCCCAATGGAGGCAAACAACTCTCGGGCGGTTGATTGCCATTCATAT
  154. GCGACCCCAGGTCAGGCGGGGCCACC
  155.  
  156. >gi|2765645|emb|Z78520.1|CSZ78520 C.segawai 5.8S rRNA gene and ITS1 and ITS2 DNA
  157. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGCAGAATATATGATCGAGTG
  158. AATCCGGTGGACTTGTGGTTACTCAGCTCGCCATAGGCTTTGCTTTTGCGGTGACCCTAATTTGTCATTG
  159. GGCCTCCTCCAAAGCTTTCCTTGTGGGTTTGAACCTCTAGCACGGTGCAGTATGCGCCAAGTCATATGAA
  160. TCATCACCGATGAATGACATTATTGTCCAAAAAGTTGGAGTAGAAGCGTGCTATTGCATGCATGCAATAG
  161. AATATTTTATGACTCTCGACAAGGGATATCTTGGCTCTTGCATCGGATGAAGAACGCAGCGAAATTGTGA
  162. TAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTATGTGAACGCAAGTTGCGCCCGATGCCATCA
  163. GGCTAAGGGCACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTGTCAATGCTTTCCTGTCATATCGAT
  164. AGGTTTGCATTGTGTGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGCGGTGGGTCTAAGGACTAGTGT
  165. TTTGATGGTTCGAAACCTGGCAGGAGGTGGAGGATGTTGGCAGCTATAAGGTTGTCATGTGAATCCCCCA
  166. TATTGTCGTGTTTGTCGGACCTGGAGAAGAACCTGTTTGAATCCCAATGGAGGCAAACAACCCTCGGGCG
  167. GTTGATTGCCATTCATATGCGACCCCAGGTCAGGCGGGCCACCCGCTGAGTTT
  168.  
  169. >gi|2765644|emb|Z78519.1|CPZ78519 C.pubescens 5.8S rRNA gene and ITS1 and ITS2 DNA
  170. ATATGATCGAGTGAATCTGGTGGACTTGTGGTTACTCAGCTCGCCATAGGCTTTGCTTTTGCGGTGACCC
  171. TAATTTGTCATTGGGCCTCCTCCCAAGCTTTCCTTGTGGGTTTGAACCTCTAGCACGGTGCAGTATGCAC
  172. CAAGTCATATGAAGCATTGCCGATGAATGACATTATTGTCCAAAAGTTGGAGTGGAAGCGTGCTACTGCA
  173. TGCATGCAAATGAATTTTTTTATGACTCTCGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGCA
  174. GCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCC
  175. CGATGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGTGCTGCGTCTCTCCTGTCAATGCTTTCCC
  176. ATCATATAGATAGGTTTGCATTGTGTGGATGTGAAAGATTGGCCCCTTGTGCCTAGGTGCGGTGGGTCTA
  177. AGAACTTAATGTTTTGATGGTTCGAAACCTGGCAGGAGGTGGAGGATGTTGGCAGCTATATAAGGCTATC
  178. ATTTGAATCCCCCATATTGTCGCGTTTGTTGGACCTAGAGAAGAACATGTTTGAATCCCAATGGAGGCAA
  179. ACAACCCTCGGGCGGTTGATTGCCATTCATATGCGACCCCAGGTCAGGCGGGGCCACCCGCTGAGTTTA
  180.  
  181. >gi|2765643|emb|Z78518.1|CRZ78518 C.reginae 5.8S rRNA gene and ITS1 and ITS2 DNA
  182. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGGAGGATCATTGTTGAGATAGTAGAATATTCGATCGAGTG
  183. AATCCGGAGGACTTGTGGTTACTCGGCTCGTCGAAGGCTTAACTTTTGTGGTGACCCTGATTTGTAGTTG
  184. GGCATCCTCGAGAGCTTTTATGGCGGGTTTGAGCCTCTATCACGGCGCAGTTTGCGCCAAGTCATATGAA
  185. GCATCGCCGACGAATTACATTATTGTCCCCCAAACTCGGATGGACGGTGTGTGTTACGCATACCCGTGAA
  186. CCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTG
  187. TGCTGCATCTCTTTTGCCAATGCTTGCTCGACATACAATTAGGCCAGTATTGCATAGATATGAAAGATTG
  188. ACCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATTGGTGTTTTGATGGCCCAAACCCCGGCAGGAGGTGG
  189. AGCATGTTGATAGTCGCAAGGCTGTCGTTCAAATCCCACATGTTGTCGTATTTGCCGGACCCACAGAAGA
  190. ACCTATTTGAACCCCTATGGAGGCAAAACAACCCTTGAGCGATTGATTGCCATTCAGATACGACCCCAGG
  191. TCAGGCGGGGCCACCCGCTGAGTTTTCC
  192.  
  193. >gi|2765642|emb|Z78517.1|CFZ78517 C.flavum 5.8S rRNA gene and ITS1 and ITS2 DNA
  194. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTAGAATATACGATCGAGTG
  195. AATCCAGAGGACTTGTGGTTACTCGGCTCGTCCAAGTCTTAGCTTTTGTGGCCCTGATTTGTCGTTGGGC
  196. ATCCTCAGGAGATTTTATGGCGGGTTTGAACCTCTATCACGGTGCAGTTTGCGCCAAGTCATATGAAGCA
  197. TCACCGATGAATGACATTATTGTCACAAAAGTCGGATGGGCGGTGTGCTGTTGTGCATGCCAATAAATTT
  198. TTGATGACTCTCGGCCAACGGATATCTTGCTCTTCCATCGATGAAGAACGCAGCGAAATGCGATAAGTGG
  199. TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCTAAG
  200. GGCACGCCTGCCTGGGCGTCGTGTGCTGCATCTCTTTTGCCAATGCTTGCCCGACATACAATTAGGACAG
  201. TATTGCATAGATATGAAAGATTGACCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATTGGTGTTTTGGTG
  202. GCCCGAACCCCGGCAGGAGGTGGATCATGTTGATAGTCGCAAGACTGTCATTCAAATCCCACATGTTGTC
  203. GTATTTGTCGGACCCACAGAAGAACCTATTTGAACCCCAATGGAGGCAAAACAACCCTCGAGCGATTGAT
  204. TGCCATTCAGATACGACCCCAGGTCAGGCGGGGCCACCCGCTGAGTTTAAGC
  205.  
  206. >gi|2765641|emb|Z78516.1|CPZ78516 C.passerinum 5.8S rRNA gene and ITS1 and ITS2 DNA
  207. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAGTATAATATATGATCGAGTG
  208. AATCCGGAGGACTTGTGGTTACTCGGCTCGTCCAAGTCTTAGCTTTTGTGGCCCTGATTTGTCGTTGGGC
  209. ATCCTCAGGAGCTTTTATGGCGGGTTTGAACCTCTATCACGGCGCAGTTTGCGCCAAGTCATATGAAGCA
  210. TCACCGACGAATGACATTATTGTCACCAAAGTCGGATGGGCGGTGTGCTATTGTGCATACCAATAATTTT
  211. TTGATGACTCTCGTCAACGGATATCTTAGCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGTGAAC
  212. CATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGT
  213. GCTGCATCTCTTTTGCCAATGCTTGCCCGACATACAATTAGGCCAGTATTGCATAGATATGAAAGATTGA
  214. CCCCTTGTGCTTAGGTGCGGTGGGTCTAAGGATTGGTGTTTTGATGTCCCGAACCCCGGCAGGAGGTGGA
  215. GCATGTTGATAGTCGCAAGACTATCGTTCAAATCCCACATGTTGTCGTATTTGTCGGACCCACAGAAGAA
  216. CCTATTTGAACCCCAATGGAGGCAAAACAACCCTCGAGTGATTGATTGCCATTCAGATATGACCCCAGGT
  217. CAGGCGGGGCCACCCGCTGAGTTTAA
  218.  
  219. >gi|2765640|emb|Z78515.1|MXZ78515 M.xerophyticum 5.8S rRNA gene and ITS1 and ITS2 DNA
  220. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCTGAGACCGTAGAATAAACGATCGAGTT
  221. AATCTGGAGGACCGGTGTACTTCGATCTCCCAGGGGCTTTCGCTACTGTGGTGGCCTTTGATCTGCCATC
  222. GGGCCTCCTTGGGAGTGTTCTTGAAGGCGATCAAACTTCTAGCCCGGCGCAGCTTCGCGCCAAGTCTTTT
  223. GAGACAAGAATCGGCATAGGGGTGTTCCCTTGTAGCCGGTGGGGGTGGCACTTGATTCGTGCCCCCCAAG
  224. TTACATTTTTACAACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGGAGGACGCAGCGAAATGCGA
  225. TAAGTGGTGTGAATTGCAGAATCCCGTGAACATCGAGTCTTTGAACGCAAGTTGCGCTCGAGGCCGTCAG
  226. GCTAAGGGCACGCCTGCCTGGGCGTTGTGTACTGTGTCTCTCCCACCAATGGTTGTCCAAGAATACCGTT
  227. CGGTCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTCGGTTCAATGGGTCTAAGACCTCGGGCTTTTGAT
  228. GGTCCAAAATTCGACAAGAGGTGGATGGGCAATGGCTGAGCCAAAGCTGTTGTGCGAATGCCGTATGTTG
  229. TCCGATTTGATGGGCCATCATAATTCGTAGGACCCTTCGGAACCCCATTGGTGCCACATCAACCCAACCC
  230. ATGGGCGGTTGATTGCCATTTGGAAGCAACCCCAGGTCAGGTGAGGCCACCCGCTGAGTTTAAGC
  231.  
  232. >gi|2765639|emb|Z78514.1|PSZ78514 P.schlimii 5.8S rRNA gene and ITS1 and ITS2 DNA
  233. CGTAACAAGGTTTCCGTAGGTGGACCTTCGGGAGGATCATTTTTGAAGCCCCCAAATATACGATCGAGAT
  234. AATCCGGAGGACCGGTGTACTTTGGTCTCCCAGGGGCTTCCGCCGCTGTGGTGACCATGATTTCCCATCG
  235. AACCTCCTTGGGAGAGTTCTCTATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCTCCAAGTCAAATG
  236. AGATAGAACCGACAAGGGTCTTCGTCCTCCATGGATGGACCGGGGAGGGCCGGCGTGCTGCTGTGCCCCC
  237. TTAAGATTCGTCTGACAACTCTCGTCAACGGATATCTCGGCTCTTGCATCGATGAAGAACCCAGCGAAAT
  238. GTGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCC
  239. ATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCAATGCTAAGGTTGAACAGCCA
  240. TACTGTTCGGCCGGCGAGGATGAGAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACTTGGGCT
  241. TGTGACGGTCCACAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACAAAGCTGTTGTGCGAATGCCC
  242. TATGTTGTCGTATTTGATGGGCCGGAATGATCCCTTTCGAACCCCGTCGGAGGCACGTCGACCCAACCCA
  243. TGGGCGGTTGACGGCCATTAGGATGCAACCCCAGGTCAGGTGAGACTACCCGCTA
  244.  
  245. >gi|2765638|emb|Z78513.1|PBZ78513 P.besseae 5.8S rRNA gene and ITS1 and ITS2 DNA
  246. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCCAAATACACGATCGAGTT
  247. AATCCGGAGGACCGGTGTACTTTGGTCTCCCAGGGGCTTCCGCCGCTGTGGTGACCATGATTTGCCATCG
  248. AGCCTCATTGGGAGATTTCTCCATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCAAATG
  249. AGATAGAACCGGCAAGGGCATCGTCCTCCATGGAGCCGGGGAGGCCGGCATGCTGCTGTGCCCGAAAGAA
  250. TTTTCGACAACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGTGATAAG
  251. TGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCT
  252. AAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCAATGCTAAGGTTGAACAGCCATACTGTTC
  253. GGCCGGCGAGGATGAGAGTTTGGCCCCTTGTTCTTCTGTGCGATGGGTCCAAGACTTGGGCTTGTGACGG
  254. TCCACAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTTTTGTGCGAATGCCCTATGTTGT
  255. CGTATTTGATGTGCCAGAACGATCCCTTTCGAACCCCTTCGGAGGCACGTCGACCCAACCCATGGGCGGT
  256. GACGCCATTAGGATGCAACCCAGTCAGTGAGCTACCGCTGAG
  257.  
  258. >gi|2765637|emb|Z78512.1|PWZ78512 P.wallisii 5.8S rRNA gene and ITS1 and ITS2 DNA
  259. CGTAACAAGGTTTCCGTAGGTGGACCTTCGGGAGGATCATTTTTGAAGCCCCCAAAAAAACGATCGAATT
  260. AATCCGGAGGGCCGGTGTAGTTTGGTCTCCCAGGGGCCTTGGCTACTGTGGTGACCGTGAATTTCCGTCG
  261. AACCCTCTGGGAGGAATTCTTGATGGCAAATGAAACCCTTGGCCCGGCGCAGTTTCGCCCCAAATCAAAT
  262. GAGATGGAACCGGCGGAGGGCATCGTCCCCCATGGAACCGGGGAGGGCCGGCGTTCTTCCGTTCCCCCAA
  263. TGAAATTATTTTTTGACAACTCTCGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAAT
  264. GTGATAAGCTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGC
  265. CATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGGCTGAACAG
  266. GCATACTGTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGG
  267. GCTTTTGACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGTGCGAATGC
  268. CCTGCGTTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCGTG
  269. GGCGGTCGACGGTCATTTGGATCCAACCCCAGGTCAGGTGAGGCCACCCGCTGAGTTTAAGC
  270.  
  271. >gi|2765636|emb|Z78511.1|PEZ78511 P.exstaminodium 5.8S rRNA gene and ITS1 and ITS2 DNA
  272. CGTAACAAGGTTTCCGTAGGTGAACCTTCGGAAGGATCATTGTTGAGACCCCCAAAAAAACGATCGAGTT
  273. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTGGCTACTGTGGTGGCCGTGAATTTCCGTCG
  274. AACCTCCTTGGGAGAATTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCCCCAAGTCAAATG
  275. AGATGGAACCGGCGGAGGGCATCGTCCTCCATGGAACCGGGGAGGGCCGGCGTTCTTCCGTTCCCCCCAT
  276. GAATTTTTTTTTGACAACTCTCGGCAACGGATATCTCGGCTCTTTGCATCCGATGAAAGAACCCAGCGAA
  277. ATGTGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGG
  278. CCATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGGCTGAACA
  279. GGCATACTGTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTG
  280. GGCTTTTGACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGTGCGAATG
  281. CCCTACGCTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAGCCCCATTGGAGGCACGTCAACCCGT
  282. GGGCGGTCGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGGA
  283.  
  284. >gi|2765635|emb|Z78510.1|PCZ78510 P.caricinum 5.8S rRNA gene and ITS1 and ITS2 DNA
  285. CTAACCAGGGTTCCGAGGTGACCTTCGGGAGGATTCCTTTTTAAGCCCCCGAAAAAACGATCGAATTAAA
  286. CCGGAGGACCGGTTTAATTTGGTCTCCCCAGGGGCTTTCCCCCCTTGGTGGCCGTGAATTTCCATCGAAC
  287. CCCCCTGGGAGAATTCTTGGTGGCCAATGGACCCTTGGCCCGGCGCAATTTCCCCCCCAATCAAATGAGA
  288. TAGGACCGGCAGGGGGCGTCCCCCCCCATGGAACCGGGGAGGGCCGGCATTCTTCCGTTCCCCCCTCGGA
  289. TTTTTTGACAACTCTCGCAACGGATATCTCGCCTCTTTGCATCGGATGGAAGAACGCAGCGAAATGTGAT
  290. AAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAG
  291. GCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCATACTG
  292. TTCGGCCGGCGCGGATGAGAGATTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGA
  293. CGGTCCAAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACAAAGCTGTCGTGCGAATGCCCTGCGTT
  294. GTCGTTTTTGATGGGCCGGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGGTTG
  295. ACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGCCACCCGCTGAGTTTA
  296.  
  297. >gi|2765634|emb|Z78509.1|PPZ78509 P.pearcei 5.8S rRNA gene and ITS1 and ITS2 DNA
  298. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCCAAATATACGATCGAGTT
  299. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTCGCCGCTGTGGTGACCGTGATTTGCCATCG
  300. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCATATG
  301. AGATAGAACCGGCGGAGGGCGTCGTCCTCCATGGAGCGGGGAGGGCCGGCATGCTCCGTGCCCCCCCATG
  302. AATTTTTCTGACAACTCTCGGCAACGGACGTAACAAGGTTTAAATGTGATAAGCAGGTGTGAATTGCAGA
  303. ATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGTTAAGGGCACGCCTGCCT
  304. GGGCGTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCATACTGTTCGGCCGGCGCGGATGAG
  305. AGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGACGGTCCAAAATCCGGCAAG
  306. AGGTGGACGGACGGTGGCTGCGACAGAGCTGTCGTGCGAATGCCCTACGTTGTCGTTTTTGATGGGCCAG
  307. AATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCAATGGGGGGTGACGGGCATTTGGTTAACCC
  308. CGGCAAGTTAAGGCACCCGTTAATTTTAGGA
  309.  
  310. >gi|2765633|emb|Z78508.1|PLZ78508 P.longifolium 5.8S rRNA gene and ITS1 and ITS2 DNA
  311. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCCAAATATACGATCGAGTT
  312. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTCGCCGCTGTGGTGACCGTGATTTGCCATCG
  313. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCATATG
  314. AGATAGAACCGGCAGGGGGCGTCGTCCTCCATGGAGCCGGGGAGGGCCGGCATGCTGCCGTGCCCCCAAT
  315. GAATTTTTTGACAACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGTGA
  316. TAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCA
  317. GGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCATACT
  318. GTTCGGCCGGCGCGGATGAGAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTG
  319. ACGGTCCAAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACAGAGCTGTCGTGCGAATGCCCTACGT
  320. TGTCGTATTTGATGGGCCGGAATAAATCCCTTTGAACCCCATTGGAGGCACGTCAACCCCATGGGCGGTG
  321. ACGGCCACTTGGATGCAACCCAGTCAGTGAGCCACCGCTGA
  322.  
  323. >gi|2765632|emb|Z78507.1|PLZ78507 P.lindenii 5.8S rRNA gene and ITS1 and ITS2 DNA
  324. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCCCCAAAAAAACGATCGAGTT
  325. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTGGCTACTGTGGTGACCGTGAATTTCCGTCG
  326. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCCCCAAGTCAAATG
  327. AGATGGAACCGGCGGAGGGCATCGTCCTCCATGGAACCGGGGAGGGCCGGCGTGCTTCCGTCCCCCAATG
  328. AATTTTTTTGACAACTCTCGCAACGGATATCTCGCTCTTGCATCGATGAAGAACACAGCGAAATGTGATA
  329. AGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGG
  330. CTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGGCTGAACAGGCATACT
  331. GTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTG
  332. ACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGTGCGAATGCCCTGCGT
  333. TGTCGTATTTGATGGGCCGGAATAAATCCCTTTGAACCCCATTGGAGGCACGTCAACCCGTGGCGGTCGA
  334. CGGCCATTTGGATGCAACCCAGTCAGTGAGCCACCGCTGA
  335.  
  336. >gi|2765631|emb|Z78506.1|PLZ78506 P.lindleyanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  337. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCAAAATATACGATCGAGTT
  338. AATCCGGAGGACTGGTGTAGTTTGGTCTCCCAGGGGCGTTGGCTACTGCGGTGACCATGATTTTCCATCG
  339. AGCCTCCTCGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCGTATG
  340. AGATAGAACCGGCAGAGGGCTTCGTCCTCCATGGAACCGGGGAGGACCGGCATGCCGCCGTACCCCCTTT
  341. GAATCGGGCTGACAACTCTCGTTCAAGGAGCCCTCAGCTCATAATGTGATAAGTGGTGTGAATTGCAGAA
  342. TCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTG
  343. GGCGTTGCGTGCTGCATCTCTCCCGTTGCTAAGGTCGAACAGGCATATACTGTTCGGCCGGCGCGGATGA
  344. GAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGACGGTAAAAAATCCGGCAA
  345. GAGGTGGACGGACGGTGGCTGCGACAAAGCTGTCGTGCGAATGCCCTACGTTGTCGTATTTGATGGGCCA
  346. GAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGGTTTGACGGCCATTGGATGCCA
  347. ACCCAGTCAGGTGAGGCCACCCGCTGA
  348.  
  349. >gi|2765630|emb|Z78505.1|PSZ78505 P.sargentianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  350. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCCAAATATACGATCGAGTT
  351. AATCCGGAGGACTGGTGTAGTTTGGTCTCCCAGGGGCGGTGGCTACTGCGGTGACCATGATATTCCATCG
  352. AGCCTCCTCGGGAGATTTCTTGATGGCAATTGAACCCGTGGCCCGGCGCAGTTTCGCGCCAAGTCGTATG
  353. AGATAGAACCGGCAGAGGTCTTCGTCCTCCATGGAACCGGGGAGGCCCGGCATACCACCATACCCCCAAT
  354. GAATCTTTGTGACAACTCTCGTCAATGTGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTC
  355. TTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCT
  356. CTCCCGTTGCTAAGGTCGAACAGGCATACTGTTCGGTCGGCGCGGATGAGAGTTTGGCCCCTTGTTCTTC
  357. GGTGCGATGGGTCCAAGACCTGGGCTTTTGACGGTAAAAAATCCGGCAAGAGGTGGACGGACGGTGGCTG
  358. CGACAAAGCTGTCGTGCGAATGCCCTGCGTTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAACCC
  359. CATTGGAGGCACGTCAACCCATGGGCGGTTGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGCCACC
  360. CGCTGAGTTTT
  361.  
  362. >gi|2765629|emb|Z78504.1|PKZ78504 P.kaiteurum 5.8S rRNA gene and ITS1 and ITS2 DNA
  363. CGTAACAAGGTTTCCGTAGGTGAACCTTCGGAAGGATCATTGTTGAGACCGCAAAATATACGATCGAGTT
  364. AATCCGGAGGACTGGTGTAGTTTGTCTCCCAGGGGCGTTGGCTACTGCGGTGACCATGATTTTCCATCGA
  365. GCCTCCTCGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCGTATGA
  366. GATAGAACCGTCAGAGGGCATCGTCCCTCCATGGAGCCGGGGAGGGCCGGCATGCCCGCCGTGCCCCCAA
  367. TGAATCTTTTTGACAACTCTCGCAACGGATATCTCGCTCTTCATCGATGAAGAACGCAGCGAAATGTGAT
  368. AAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGCCATCAGG
  369. CTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCGTTGCTAAGGTCGAACAGACATACTGT
  370. TCGGCCGGCGCGGATGAGAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGAC
  371. GGTACCAAATCCGACAAGAGGTGGACGGACGGTGGCTGCGACAAAACTGTCGTGCGAATGCCCTACGTTG
  372. TCGTATTTGATGGGCCAGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGGTGAC
  373. GGCCATTGGATGCAACCCCAGTCAGTGAGCCACCGCTGAGTAA
  374.  
  375. >gi|2765628|emb|Z78503.1|PCZ78503 P.czerwiakowianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  376. CGTAACCAGGTTTCCGTAGGTGAACCTCCGGAAGGATCCTTGTTGAGACCGCCAAATATACGATCGAGTT
  377. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTCGCCGCTGTGGTGTCCGTGATTTACCATCG
  378. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCATGGCCCGGCGCAGTTTCGCGCCAAGTCATATG
  379. AGATAGAACCGGCAGGGGGCGTCGTCCTCCATGGAACCGGGGAGGGCCGGCATGCTACCGTACCCCCAAT
  380. GAATTATTTTGACAACTCTCGGCAACGGAGTCTCAGCTCTTTGTGATAAGTGGTGTGAATTGCAGAATCC
  381. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGC
  382. GTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCATACTGTTCGGCCGGCGCGGACGAGAGTT
  383. TGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTTTGACGGTCCAAAATCCGGCAAGAGGT
  384. GGACGGACGGTGGCTGCGACAAAGCTGTCGTGCGAATGCCCTACGTTGTCGTATTTGATGGGCCAGAATA
  385. AATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGGTTGACGGCCATTTGGATGCAACCCCA
  386. GGTCAGGTGAGCCACCCGCTGAGATAA
  387.  
  388. >gi|2765627|emb|Z78502.1|PBZ78502 P.boissierianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  389. CGTAACCAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGACCGCCAAATATACGATCGAGTT
  390. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTCGCCCCTGTGGTGACCGTGATTTGCCATCG
  391. AGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCATGACCCGGCGCAGTTTCGCGCCAAGTCATATG
  392. AGATAGAACCGGCAGGGGTCGTCGTCCTCCATGGAGCCGGGGAGGGCCGGCATACTACCGTCCCCCCAAT
  393. GAATTTTATATTGACAACTCTCGGCCGGAATCTCGGCTCTTGCATCGATGGAAGGACGCAGCGAAAATGT
  394. GATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT
  395. CAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCCCATTGCTAAGGTTGAACGGGCGTA
  396. CTGTTCGGCCGGCGCGGACGAGAGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAGACCTGGGCTTT
  397. TGACGGTCCAAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACAAAGCTGTCGTGCGAATGCCCTAC
  398. GTTGTCGTATTTGATGGGCCAGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAACCCATGGGCGG
  399. TTGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGGCCACCCCGTGAGTTTACGC
  400.  
  401. >gi|2765626|emb|Z78501.1|PCZ78501 P.caudatum 5.8S rRNA gene and ITS1 and ITS2 DNA
  402. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACCGCAAAATATACGATCGAGTT
  403. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTGGTTACTGTGGTGACCGTGACTTTGCCGTC
  404. GAGCCTCCTTGGGAGATTTCTTGATGGAAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCATAT
  405. GAGATGGAACCGGCGGAGGGAATCGTCCTCCATGGAGCCGGGGAGGGCCGGCGTGTTGCCGTGCCCCCAA
  406. TGAATTTTTTTTTGGGCAACTCTCGGCCAAACGGGAAATCTCGGCTCCTTGCATCGGATGGAAGGACGCA
  407. GCGAAATTGTGATAAGTGTTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTTGAACGCAAGTTGCG
  408. CCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGG
  409. CTGAACAGGCATACTGTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCA
  410. AGACCTGGGCTTTTGACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGA
  411. GCGAATGCCCTACGCTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTC
  412. AACCCGTGGGCGGTCGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGGCCACCCGCTGAGTTTAAGA
  413.  
  414. >gi|2765625|emb|Z78500.1|PWZ78500 P.warszewiczianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  415. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGCTCATTGTTGAGACCGCAAAATAATTGATCGAGTT
  416. AATCCGGAGGACCGGTGTAGTTTGGTCTCCCAGGGGCTTTGGTTACTGTGGTGACCGTGACTTTGCCGTC
  417. GAGCCTCCTTGGGAGATTTCTTGATGGCAATTGAACCCTTGGCCCGGCGCAGTTTCGCGCCAAGTCATAT
  418. GAGATGGAACCGGCGGAGGGCATCGCCCTCCATGGAGCCGGGGAGGGCCGGCGTCCTGCCGTGCCCCCAA
  419. TGAATTTTTCTTTGGGAAAACTTCTCGGCCAACGGGAATCTCGGCTCTTTGCATCGGATGGAAGGACGCA
  420. GCGAATTGTGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCC
  421. CGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTTGCGTGCTGCATCTCTCTCCCATTGCTAAGGCT
  422. GAACAGGCATACTGTTCGGCCGGCGCGGATGAGTGTTTGGCCCCTTGTTCTTCGGTGCGATGGGTCCAAG
  423. ACCTGGGCTTTTGACGGCCGGAAATCCGGCAAGAGGTGGACGGACGGTGGCTGCGACGAAGCTGTCGTGC
  424. GAATGCCCTACGCTGTCGTATTTGATGGGCCGGAATAAATCCCTTTTGAACCCCATTGGAGGCACGTCAA
  425. CCCGTGGGCGGTCGACGGCCATTTGGATGCAACCCCAGGTCAGGTGAGGCCACCCGCTGAGTTTAAG
  426.  
  427. >gi|2765624|emb|Z78499.1|PMZ78499 P.micranthum 5.8S rRNA gene and ITS1 and ITS2 DNA
  428. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAGGGATCATTGTTGAGATCGCATAATAATTGATCGAGAT
  429. AATCCAGAGGATCGGTTTACTTTGGTCACCCTTGGGCGCCTGCTATTGCGGTGACCTAGATTTTCCATGG
  430. AGGGAGCCTCCTTGGGAGCTTTCTTGCCGGCGATCTAACCCTTGCCCGTCGCAGTTTTGCACCAAGTCAT
  431. ATGACACATAAATGGTGAAGGACATACCCCCTTCGTTGAATTCGAGGAGGGGACGGCATGTGGCCTTGAC
  432. CTCTCCCAATTATTTTTTTGACAACTCTCAGCCAACGGATATCTCGGCTCTTTGCATCGGATGGAGGACG
  433. CAGCGAAATGCGATAAGTGTGTGAATTGCAAGATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGC
  434. CCAAGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTC
  435. CATGCATACTGTTCAGCCGGTGCGGATGTGAGTTTGCCCCCTTGTTCTTTGGTGCTGGGGGTCTAAGAGC
  436. TGCAGGGGCTTTTGATGGTCCTAAATTCGGCAAGAGGTGGACGAATCATGCTACAACAAAACTGTTGGGC
  437. GAATGCTCCAGGTTGTCGTATTAGATGGGCCATCATAATCTAGAGACCCTTGTGAACCCCATTGGAGGCC
  438. CATCAACCCATGATCAGTTGATGGCCTTTTGGATGCGACCCCAGGTCAGGTGAGCAACC
  439.  
  440. >gi|2765623|emb|Z78498.1|PMZ78498 P.malipoense 5.8S rRNA gene and ITS1 and ITS2 DNA
  441. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAAGGTCATTGTTGAGATCACATAATAATTGATCGAGTT
  442. ACTCCAGAGGATCAGTTTACTCCGGTCACCCATGGGTGCTTGCTATTGCGGTGACCTAGATTTGCCATGG
  443. AGCCTCCTTGGGAGTTTTCTTGCCGGCGATCTTACCCTTGCCCGGGGCAGTTTTGCCCCAAGTCATATGA
  444. CACAATAATGGCGAAGGAGGGGGCGGCATTTTGCCCTTGACCCTACAATCACTCCCCCTCTCCAAATTAT
  445. TTTTGGACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACCCAGCGAAATGCGATAAG
  446. TGGTGTGAATTGCAGGATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGCC
  447. AAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTACATGCATACTGTTCA
  448. GCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTCGGTGCTGGGGGTCTAAGAGCTGCAGGGGCTTTTGA
  449. TGGTCCTAAATTCGGCAAGAGGTGGACGAATTACAACAAAACTGTTGTGCGAATGCTCCAGGTTGTCGTA
  450. TTAGATGGGCCAGCATAATCTAAAGACCCTTGTGAACCCCACTGGAGGCACATCAACCCGTGATCAGTTG
  451. ATGGCCATTTGTTGCGACCCCAGTCAGTGAGCAACCCGCTGAGTTTAAGC
  452.  
  453. >gi|2765622|emb|Z78497.1|PDZ78497 P.delenatii 5.8S rRNA gene and ITS1 and ITS2 DNA
  454. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTG
  455. AATCCAGAGGATCAGTTTACTTTGGTCGCCCATGGGCGCTTGCTATTGCGGTGACCTAGATTTGCCATGG
  456. AGCCTCCTTGGGAGCTTTCTTGCCGGCGATCTAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCACATGA
  457. CACATAAATGGTGAAGGGCACGGCCCTTTGTGAATTCAAGGAGGTGAAGGGCATGTGGCCTTGAGCCTAC
  458. ACTCCCTCCCCCTCTCCAAATTATTTTTTGTGAAACAACTCTCAGCAACGGAGATCTCAGCTCTTGCATC
  459. GATGAAGGAACGCAGCGAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGA
  460. ACGCAAGTTGCGCCCAAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCC
  461. TTAACGAGGCTGTCCAGGCATACTGTTCAGCCGGTGCGGGTGTGAGTTTGGCCCCTTGTTCTTTGGTGCT
  462. GGGGGTCTAAGAGCTGCAGGGGCTTTTGATGGTCCTAAATTCGGCAAGAGGTGGACGCAACGCGCTACAA
  463. CAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAACACCCTTGTGAA
  464. CCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAGGTGAGGC
  465. AACCCGCTGAGTTTAAGC
  466.  
  467. >gi|2765621|emb|Z78496.1|PAZ78496 P.armeniacum 5.8S rRNA gene and ITS1 and ITS2 DNA
  468. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATCGAGTT
  469. AATCCAGAGGATCGGTTTACTTTGGTCACCCTTGGGCGCCTGCTATTGCGGTGACCTAGATTTGCCATGG
  470. AGGGAGCCTCCTTGGGAGCTTTCTTGCCGGCGATCTAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCAT
  471. ATGACACATAATTGGTGAAGGGCATATCCCTTCGTGAATTCGAGGAGGGGCCGGCATGTGGCCTTGACCT
  472. CTCCAATTAATTTTTTGAACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGGAGGGACGCACC
  473. GAAATGCGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTTGAACGCAAGTTGCGCCC
  474. AAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCC
  475. ATGCATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTGCTGGGGGTCTAAGAGCT
  476. GCAGGGGCTTTTGATGGTCCTAAATTCGGCAAGAGGTGGACGAATCATGCTACAACAAAACTGTTGGGCG
  477. AATGCTCCAGGTTGTCGTATTAGATGGGCCATCATAATCTAGAGACCCTTGTGAACCCCATTGGAGGCCC
  478. ATCAACCCATGATCAGTTGATGGCCTTTTGGGTTGCGACCCCAGGTCAGGTGAGGCAACCAGCTGAGTTT
  479. AAGC
  480.  
  481. >gi|2765620|emb|Z78495.1|PEZ78495 P.emersonii 5.8S rRNA gene and ITS1 and ITS2 DNA
  482. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGAT
  483. AATCCAGAGGATCGGTTTACTTTGGTCACCCATGGGCGCTTGCTATTGCGGTGACCTAGAGTTGCCATGG
  484. AGAGCCTCCTTGGGAGCTTTCTTGCCGGCGATCTAACCCTTGTCCGGCGCGGTTTTGCGCCAAGTCATAT
  485. GACACATAATTGGTGAAGGGCATAGCCCTTCGTGTATTCAAGGAGGGGGGGCGGCATGTGGCCTTGACAC
  486. TGCACTCGCTCTCCCCCTCTCCAAAGTATTTTTCTGAACAACTCTCAGCAACGGATATCTCAGCTCTTGC
  487. ATCGGATGGAGGAACGCAGCGAAATCCGATAAGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCT
  488. TTTGAACGCAAGTTGCGCCCGAGGCCATGAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATCTCT
  489. CTCCCTCAATGAGGCTGTCCATGCATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTG
  490. GTGCTGGGGGTCTAAGAGCAGCAGGGGCTTTTGATGGTCCTAAATTCGGCAAGAGGTGGACGAATCAGGC
  491. TACAACAACACTGTTGTTGTGCGAATGCTCCAGGTTGTCGTATTAGATGGGCCGGCATAATCCAGAGACC
  492. CTTGTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTCGGTTGCGACCCCAGGTCA
  493. GTGAGCAACCCGCTGAGTG
  494.  
  495. >gi|2765619|emb|Z78494.1|PNZ78494 P.niveum 5.8S rRNA gene and ITS1 and ITS2 DNA
  496. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGGTCGCATAATAATTGATCGAGTT
  497. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGACATTTACTGTTGCAGTGACCTAGATTTACCATCG
  498. GGCCTCCTTGGGAACTTTCCTGCTGGCGATCTATACCCTTGCCCGGCGCAGTAATGCGCCAAATCAAATG
  499. ACCCATAATTAATGAAGGGGGACGGCATACTGCCTTGACCAACTCCCCATTATTGAGGTAACACTCTCAA
  500. CTTCGGATATCTCAGGTGTGAATTGCAGAATCCCGTTAACATCGAGTCTTTGAACGCAAGTTGGGCCCGA
  501. GGCCAACAGGCCAAGGGAACGCCTGTCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCAT
  502. ACGTACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTCGGTACGGGGGGTCTAAGAGCTGC
  503. ATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAA
  504. TGCCCCGGGTTGTTGTGTTTAATCAGAAGACCCTTTTGAACCCCATTGGAGGCCCATCGACCCATGATCA
  505. GTTGAATGGCCATTTGGTTGCGATCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAAG
  506.  
  507. >gi|2765618|emb|Z78493.1|PGZ78493 P.godefroyae 5.8S rRNA gene and ITS1 and ITS2 DNA
  508. CGTAACAAGGATTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATCGAGTT
  509. AATCTGGAGGATCGGTTTACTTTGGTCACCCATGGGCATTTTCTGTTGCAGTGACCTAGAATTTCCATCG
  510. GGCCTCCCTGGGAGCTTTCCTGCTGGCGATCTATACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCAAATT
  511. TTACATAAGTGGTGAAGGGGGGCGGCATTCTTCCTTGACCAGCCCCCAAGTATTTAGGTAACAACTCTCA
  512. GCAACGGATATCTCGGCTCATGCATCGATGAAGGAACGCAGCGAGATTCGATAAATGGTGTGCCTTGCAG
  513. AATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCGCGAGGCCATCAGCCCAAGGGGACGCCTGCC
  514. TGGACATTGCGACTCATATCTCTCCCTTAATGAGGCTGTCCAAACGTACTGGTCATCCGGTGTGGATGTG
  515. AGTTTGGCCCCTTGTTCTTCGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGG
  516. CAAGAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTTGTGTTTAATCAGA
  517. AGACCCTTTTGAACCCCATTGGAGGCCCATCGACCCATGATCAGTTGAATGGCCATTTGGTTGCGATCCC
  518. AGGTCAGGTGAGGCAACCC
  519.  
  520. >gi|2765617|emb|Z78492.1|PBZ78492 P.bellatulum 5.8S rRNA gene and ITS1 and ITS2 DNA
  521. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATCGAGTT
  522. AATCTGGAGGATCAGTTTACTTTGGTCACCCACGGGCATTTGCTGTTGCAGTGACCTAGAATTTGCCATC
  523. GAGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTATACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATAT
  524. GTCACATAATTGGTGAAGGGGGGGAGCGTACTGCCTTGACCCACTCCAAATTATTTTTTTAACAACTCTC
  525. AGCAACGGATATCTCGGCTCTTGCATCGATGTAGAACCCAGCGAAATGCGATACTGGTGTGATTTGCAGA
  526. ATCCCGTGGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCT
  527. GGGCATTGCGAGTCAAATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGA
  528. GTTTGGCCCCTTGTTCTTTGGGACGGGGGGTCTAAGAGCTGCACGGGCTTTTGATGGTCCTAAATACGGC
  529. AAGAGGTGGACGAATTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTTGTGTTACATGGGCC
  530. AGCTTAATCAGAAGACCCTTTTGGACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATTGGCCATTT
  531. GGTTGCGATCCCAGTCAGGTGAGGCACACCGCTGAGTTTAATA
  532.  
  533. >gi|2765616|emb|Z78491.1|PCZ78491 P.concolor 5.8S rRNA gene and ITS1 and ITS2 DNA
  534. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATCGAGTT
  535. AATCTGGAGGATCAGTTTACTTTGGTCACCCACGGGCATTTGCTGTTGCAGTGACCTAGATTTGCCATCG
  536. GGCCTCCTTAGGAGCTTTCTTGCTGGCGATCTATACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  537. ACACATAATTGGTGTTGGGGGGAGGCGTGCTGCCTTGACCCGCTCCAAATTATATTTTTAACAACTCTCA
  538. GCAACGGATATCTCGGCTCTTGCATCGATGAAGAACCAGCGAAATGCGATAAATGGTGTGAATTGCAGAA
  539. TCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTG
  540. GGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAG
  541. TTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCA
  542. AGAGGTGGACGAACTATGCTACAACAAAATGTTGTGCGAATGCCCCGGGTTGTTGTGTTACATGGACCAG
  543. CATAATCAGAAGACCCTTTGGACCCCATTAGAGGCCCATCAACCCATGATCAGTTGAATGGCCATTTGTT
  544. GCGATCCCAGTCAGGTGAGCAACCCGCTGAGATAAGC
  545.  
  546. >gi|2765615|emb|Z78490.1|PFZ78490 P.fairrieanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  547. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  548. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGCAGTGACCGAGATTTGCCATCG
  549. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTGAACCCTAGTCCGGCGCAGTTTTGCGCCAAGTCATATG
  550. GCACATAATTGGTGAAGGGGGCGGCATGCTGCCTCGACCCTCCCCAAATTATTTTTTAACAACTCTCAGC
  551. AACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAAT
  552. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGG
  553. GCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCAAACATACTGTTCAGCCGGTGCGGATGTGAGT
  554. TTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAACGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAA
  555. GAGGTGGACGACTGTTCTGCAACAAGTGTTGTGCGAATGCCCCGCGTTGTCGTATTAGATGGGCCAGCAT
  556. AATTTGAAGACCCTTTTGAACCCCATTGGAGGCCCGTCAACCCATGATCAGTTGACGGCCATTTGGTTGC
  557. GACCCCAGTCAGGTGAGCAACCAGCTGA
  558.  
  559. >gi|2765614|emb|Z78489.1|PDZ78489 P.druryi 5.8S rRNA gene and ITS1 and ITS2 DNA
  560. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  561. AATCTGGAGGATCAGTTTACTTTGGTCACCCGAGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCG
  562. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCGAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  563. ACACATAATTGGTGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAGATTATTTTTTAACAACTCTCAGC
  564. AACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAAT
  565. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGG
  566. GCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGGGGATGTGGGT
  567. TTGGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCATGGGATTTTGATGGTCCTAAATACGGCAA
  568. GAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGAGTTGTCGTATTAGATGGGCCCA
  569. GCATATCTGAAGACCCTTTTGAACCCCATGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTT
  570. GCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAGGC
  571.  
  572. >gi|2765613|emb|Z78488.1|PTZ78488 P.tigrinum 5.8S rRNA gene and ITS1 and ITS2 DNA
  573. CTGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACGCAATAATTGATCGAGTTAATCTGGAGGATC
  574. AGTTTACTTTGGTCACCCATGGGCATTTGTTATTGCAGTGACCGAGATTTGCCATCGAGCCTCCTTGGGA
  575. GCTTTCTTGCTGGCGATCTTAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATACGACACATAATTGGT
  576. GAAGGGGGCGGCATGGTGCCTTGACCCTCCCCTAATTATTTTCTAACAACTCTCATCAACGGGATGGAGA
  577. ACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACCCAAGTT
  578. GCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCAAATCTCTCCCTTAATGAGG
  579. CTGTCCATACATACTGTTCAACCGGTGCGGATGTGAGTTTGCCCCCTTGTTCATTGGTACGGGGGGTCTA
  580. AGAGCTGCATGGGCTTTTGATGGTCCTAAAAACGGCAAGAGGTGGACGAACAACGCCACAACCAAACTGT
  581. TGTGCGGATCCCCCGGGTTGTCGTATTAGATGGGCCATCATAATCTGAAGACCCTTTTGAACCCCATCGG
  582. AGGCCCATCAACCCATGATCAGTTGATGGACATTTGTTGCGACCCCAGTCAGGTGAGCAACCGGCT
  583.  
  584. >gi|2765612|emb|Z78487.1|PHZ78487 P.hirsutissimum 5.8S rRNA gene and ITS1 and ITS2 DNA
  585. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  586. ACTCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTATTGCAGTGACCGGGATTTGCCATCG
  587. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  588. ACACATAATTGGTGAAGGGGGCGGCATGCTGCCTTTACCCTCCCCAAATTATTTTTTAACAACTCTCAGC
  589. AACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAAT
  590. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGG
  591. GCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATATTGTTCAGCCGGTGCGGATGTGAGT
  592. TCGGCCCCTTGTTCTTCGGTACGGGGGGTCTAAGAGCAGCATGGGCTATCGATGGTCCTAAATGCGGCAA
  593. GAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAG
  594. CGTAATCTAAAGACCCTTTTGAACCCCATTAGAGGCCCATCAACCCATGATCAGTTGGGGCCACTTGTTG
  595. CGACCCCAGTCAGGTGAGCAACCGCTGAGTAA
  596.  
  597. >gi|2765611|emb|Z78486.1|PBZ78486 P.barbigerum 5.8S rRNA gene and ITS1 and ITS2 DNA
  598. CGTCACGAGGTTTCCGTAGGTGAATCTGCGGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGAT
  599. TATCTGGAGGATCAGTTTACTTTGGTCACCCATGGACATTTGCTATTGCAGTGCCCGAGATTTGCCATCG
  600. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  601. ACACATAATTGGTGAAGGGTGCGGCATGGTGCCTGACCCTCCCCAAATTATTTCTTAACAACTCTCAGCA
  602. ACGGATATCTCGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCC
  603. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGC
  604. ATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTT
  605. GGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGTGGGCTTTTGATGGTCCTAAATACGGCAAGA
  606. GGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCA
  607. TAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTAG
  608. CGACCCCAGGTCAGGTGAGGCAACCCGCTGA
  609.  
  610. >gi|2765610|emb|Z78485.1|PHZ78485 P.henryanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  611. CTGAACCTGGTGTCCGAAGGTGAATCTGCGGATGGATCATTGTTGAGATATCATAATAATTGATCGAGTT
  612. AATCTGGAGGATCAGTTTACTTTGGTCACCATGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCGA
  613. GCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGGGCAGTTTTGCGCCAAGTCATATGA
  614. CACATAATTGGTGAAGGGTGCGGCATGGTGCCTTGACCCTCCCCAAATTATTTCTTAACAACTCTCAGCA
  615. ACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATC
  616. CCCGTGAACATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGG
  617. CATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTGCAGCCGGTGCGGATGTGAGTT
  618. TGGGCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGTGGGCTTTTGATGGTCCTAAATACGCCAAG
  619. AGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGACGGGCCAGC
  620. ACAATCTAAAGACCCCTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATGTGTTG
  621. CGACCCCAGTCAGCTGAGCAACCCCTGATTTAGTA
  622.  
  623. >gi|2765609|emb|Z78484.1|PCZ78484 P.charlesworthii 5.8S rRNA gene and ITS1 and ITS2 DNA
  624. CGTAACAAGGTTTCCGTAGGTGAACCTGGGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  625. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGGCTATTGCAGTGACCGAGAGTTTACCAT
  626. CGAGCCTCCATGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGGCCCAAGTCATA
  627. TGACACATAATTGTGAAGGGGCGGCATGTTTCCTACCCTCCCAACTCTCAGCAACGGATATCTCGCTCTT
  628. GCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCT
  629. TGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTC
  630. TCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCATTGG
  631. TACGGGGGGTCTAAGAGCTGCGTGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCT
  632. ACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTT
  633. GACACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGTCCATTGGGTTGCGACCCCAAGTCAGGT
  634. GAAGCAACTCCCTGAGTTTT
  635.  
  636. >gi|2765608|emb|Z78483.1|PVZ78483 P.villosum 5.8S rRNA gene and ITS1 and ITS2 DNA
  637. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  638. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCG
  639. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  640. ACACATAATTGGTGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCCAAATTATTTTTTAACAACTCTCAG
  641. CAACGGAAATCTGGCCTCTTGCATGGATGAAGACCAAACCGAAATCATAAATGGTGTGAATTGCAGAATC
  642. CCGTGAACAATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGG
  643. CATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCACACATATCTGTTCAGCCGGTGCGGATGTGAGT
  644. TTGGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGTTGGTCCTAAATACGGCAA
  645. GAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAG
  646. CATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGT
  647. TGCGACCCCAGGTCAAGTGAAGCAACCCCTGAGTTTAGCA
  648.  
  649. >gi|2765607|emb|Z78482.1|PEZ78482 P.exul 5.8S rRNA gene and ITS1 and ITS2 DNA
  650. TCTACTGCAGTGACCGAGATTTGCCATCGAGCCTCCTGGGAGCTTTCTTGCTGGCGATCTAAACCGTAGC
  651. CCGGCGCAGTTTTGCGCCAAGTCATATGACACATAATTGGTGAAGGGGGCGGCATGCTGCCTTGACCCTC
  652. CCCAAATTATTTTTTAACAACTCTCNGCAACGGATATCTCGCCTCTTCATCGATGAAGAACGCAGCGAAA
  653. TGCGATAAATGGTGTGAATTGCAGAATCCCGTGAANCCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGG
  654. CCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATAC
  655. ATACTGTTCAGCCGGTGCGGATGTGCGTTTGGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGT
  656. GGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATG
  657. CCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCA
  658. ACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAGCA
  659.  
  660. >gi|2765606|emb|Z78481.1|PIZ78481 P.insigne 5.8S rRNA gene and ITS1 and ITS2 DNA
  661. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  662. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCG
  663. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  664. ACACATAATTGGCGAAGGGGGCGGCATGGTGCCTTGACCCTCCCCAAATCATTTTTTTAACAACTCTCAG
  665. CAACGGAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCACACATAC
  666. TGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGTGGGC
  667. TTTTGTTGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAACTGTTGTGCGAATGCCCC
  668. GGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCC
  669. ATGATCAGTTGA
  670.  
  671. >gi|2765605|emb|Z78480.1|PGZ78480 P.gratrixianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  672. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  673. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTATTGCAGTGACCGAGATTTGCCATCG
  674. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  675. ACACATAATTGGCGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTTAACAACTCTCAGC
  676. AACGGATAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTCAATGAG
  677. GCTGTCCACACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCATTGGTACGGGGGGTCT
  678. AAGAGCTGCGTGGGCTTTTGTTGGTACCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAAAT
  679. GTTGTGCGAATGCCCCGGGTTGTCGTATAGATGGGCCAGCATAATCTAAAGACCCTTTTGAACCCCATTG
  680. GAGGCCCATCAACCCATGATCAGTTGA
  681.  
  682. >gi|2765604|emb|Z78479.1|PPZ78479 P.primulinum 5.8S rRNA gene and ITS1 and ITS2 DNA
  683. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  684. AATCAGGAGGATCAGGTTACTTTGGTCACCCATGGGCATTTGCTGTTTCAGTGACCTAGATTTGCCATCG
  685. AGCCGAACTAAACCCTTGCCCGGCGCAGATTTGCGCCAATTTATATGAGACATTACTGGAAGGGGAGGGA
  686. TGCTGCCTTGCCTTGCCCCCCAAATTATTTTTTAACAACTCTCAGCAACGGATATCTCGCCTCTTGCATC
  687. GATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATACAGAGATCCCGTGAACCATCGAGTCTTGAAC
  688. GCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGACATATCTCTCCCTT
  689. AATGAGGCTGTCGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGA
  690. GCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCGACAACAGAACTGTTGT
  691. GCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAACCCCATTGGAGG
  692. CCCATCAACCCAAGATCAGTTGACGGCCATTTGGATGCGACCCCAGGTCAGGTGAGGCAACCCTCTGAGT
  693.  
  694. >gi|2765603|emb|Z78478.1|PVZ78478 P.victoria 5.8S rRNA gene and ITS1 and ITS2 DNA
  695. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCAGTGTTGAGATCACATAATAATTGATCGAGTT
  696. AATCTGGGGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGCAGTGGCCTAGAGTTTGCCATC
  697. GAGCCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATGACACATAACTGGAAGGGGCGGC
  698. ATGCTGCCATGGCTCCCCCAAATATTGATAATGGCGTGATAGCAGATCCCTGAACATCGAGTTTTGAACG
  699. CATGTTGCGTCCGAGGCCATCAGGTCAAGGGGACGCCTGCCTGGAAATTGTGAGACATATCTCTCCCTTA
  700. ATGAGGCTGCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTCCTTTGGTACGGGGG
  701. TCTAAGAGCTGTATGGGTTGGATGGTCCTAAATACGGCAAGAGGTGGACGAGCTATGTGACAACAGAACT
  702. GTTGTGCGAATGCCCCGGTTGTCGTTTAGATGGGTCAGCATAATCTAAAGACCCTTTTGACCCCCATTGG
  703. AGGCCCATCAACCCATTATCAGTTGAGGACATTTGGTTGCGACCCAGGTCAGATGAGGCACCCGCTGAGT
  704. TTAGGC
  705.  
  706. >gi|2765602|emb|Z78477.1|PVZ78477 P.victoria 5.8S rRNA gene and ITS1 and ITS2 DNA
  707. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATGATAATTGATCGAGTT
  708. AATCTGGAGGATCAGTTTGCTTTGGTCACCCATGGGCATTTGCTGTTGCAGTGACCTAGATTTGCCATCG
  709. AGCCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATGACACATAATTGGAAGGGGCGGCA
  710. TGCTGCCTTGCCCTCCCCAAATATTTGTTAACCAACTCTCAGCAACGAGTATCTCGGCTCTTGCATCGGA
  711. TGGAAGGACGCAGCGAAATGCGATAAATGGTGTGAATTGCAAGAATCCCTGAACCATCGAGTCTTTGGAA
  712. CGCAAGTTGCGGCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGACATATCTCTCCCT
  713. TAATGAGGCTGTCCACACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGG
  714. GGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCGACAAC
  715. AGAACTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAAC
  716. CCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTGCGACCCCAGGTCAGGTGAGGCA
  717. ACCGCTGAGTTTATGC
  718.  
  719. >gi|2765601|emb|Z78476.1|PGZ78476 P.glaucophyllum 5.8S rRNA gene and ITS1 and ITS2 DNA
  720. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATGATAATTGATCGAGTT
  721. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGTAGTGACCTAGATTTGCCATCG
  722. AGCCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATGACACATAATTGGAAGGGCGGCAT
  723. GCTGCCTTGGCCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTCGGCTCTTAGGCCAT
  724. CCGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGACATATCTCTCCCTTAATGAGGCTGTCCATACATAC
  725. AGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGC
  726. TTTTGATCCACCTAAATACGGCAAGAGGTGGACGAACTATGCGACAACAGAACTGTTGCGCGAATGCCCC
  727. GGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGAATCCCATTGGAGGCCCATCAACCC
  728. ATGATCAGTTGACGGCCATTTGGTTGCGACCC
  729.  
  730. >gi|2765600|emb|Z78475.1|PSZ78475 P.supardii 5.8S rRNA gene and ITS1 and ITS2 DNA
  731. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  732. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  733. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCGTCCCGGCGCAGTTTTGCGCCAAGTCATATGA
  734. CACATAATTGGAAGGGGGTGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTTTGACAACTCTCAGCAA
  735. CGGATATCTCGGCTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  736. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCAGGCCAAGGGCACGCCTGCCTGGG
  737. CATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCAATGCGGATGTGAGTT
  738. TGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCAAAATACGGCAAG
  739. AGGTGGACGAACTATGCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGC
  740. ATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTT
  741. GCGACCCAGGTCAGGT
  742.  
  743. >gi|2765599|emb|Z78474.1|PKZ78474 P.kolopakingii 5.8S rRNA gene and ITS1 and ITS2 DNA
  744. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACGTAATAATTGATCGAGTT
  745. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTTCAGTGACCTGGATTTGCCATCG
  746. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCCAATCATATG
  747. ACACATAATTGGAAGGGCGGCATCCTGCCTTGACCCTCCCCAAATTATATTTTTGACAACTCTCAGCAAC
  748. GGATATCTCGCCTCTTGCATCGATGAAGACACAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCG
  749. TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
  750. TGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGG
  751. CCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCAAAATACGGCAAGAGG
  752. TGGACGAACTATGCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATA
  753. ATCTACAGACCCTTCTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTGCG
  754. ACCCCAGGTCAGGTGAAGCAACCCGTTGAGCTT
  755.  
  756. >gi|2765598|emb|Z78473.1|PSZ78473 P.sanderianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  757. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
  758. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGTAGTGACCTGGATTTGCCATCG
  759. AGCCTCCATGGGAGCTTTCTTGGTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  760. ACACATAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTGTTAACAACTCTCAGCA
  761. ACGGATATCTCGGCTCTTCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATC
  762. TCTCCCTTCAATGAGGCTGTCCATACATACTGTTCAGTCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
  763. GCCTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTACCTAAATACGGCAAGAGGTGGACGAACTA
  764. TGCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACC
  765. CTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTGCGACCCAGG
  766.  
  767. >gi|2765597|emb|Z78472.1|PLZ78472 P.lowii 5.8S rRNA gene and ITS1 and ITS2 DNA
  768. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  769. AATCTGGAGGATCAGTTTACTTTAGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  770. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAATCGTTGCCCGGCGCAGTCTTGCGCCAAGTCATTTC
  771. ACACATAATTGGAAGGGGGCGGCATGCAGTCTAAGACCCTCCCCAAATTATTTTTTGATAACTCTCAGCA
  772. ACGGAATCTCGGCTCTTGCATCGATGGAGGACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCC
  773. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGC
  774. ATTGCGAGTCATATCTCTCCTTTAATGAGGCTGTCTATACATACTGTTCAGCCACAGCGGATGTGAGTTT
  775. GGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCTTAAATACGGCAAGA
  776. GGTGGACGAAGTATGCTACAACAAAATTGTAGTTCGAATGCCCAGGGTTGTCGTATTAGATGGGCCAGCA
  777. TAATCTAAAGACCCTTTGAACCCCTTTAGAGGCCAATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
  778. GACCCCAAGTCAGGTGAGGCAACCGCTGAGTTTAAGC
  779.  
  780. >gi|2765596|emb|Z78471.1|PDZ78471 P.dianthum 5.8S rRNA gene and ITS1 and ITS2 DNA
  781. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  782. AATCTAGAGGATCGGTTTACTTTGGTCACCCATGGGCATCTGCTCTTACAGTGACCTGGATTTGCCATCG
  783. AGCCTCCTTGGGAGCTGTCTTGCTGGCGATCTAAATCGTTGCCCGACGCAGCCTTGCGTCAAGTCACCCC
  784. GACACATAATGGAAGGGGGCGGCATGCTGCCTTGACCCTTCCCCAAATTAATTTTTTGACAACTCTCAAC
  785. ATCGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAAT
  786. CCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCTTGG
  787. GCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCAGTGCGGATGTGAGT
  788. TTGGCCCCTTGTTCTTTAGTACGGGGGGTCTAAAAGCTGCATGGGCTTTTGCTGGTCCTAAATACGGCAA
  789. GAGGTGGACAAAGTATGCTACAACAAAATTGTAGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAG
  790. CATAATTTAAAGACCCTTTTGAACCCCATTAGAGGCCCATCAACCCTGATCAGTTGATGGCCATTTGGTT
  791. GCGACCCCAAGTCAGGTGAGGCAACCCGCTGAGTTTAAGC
  792.  
  793. >gi|2765595|emb|Z78470.1|PPZ78470 P.parishii 5.8S rRNA gene and ITS1 and ITS2 DNA
  794. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  795. AATCTAGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTACAGTGACCTGGATTTGCCATCG
  796. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAATCGTTGCCCGACGCAGCCTTGCGTCAAGTCATATG
  797. ACACATAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTTCCCAAATTATTTTTTTAAGTTGCGCCCGAG
  798. GCCATCAGGCCAAGGGCACGCCTGCTTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATA
  799. CATACTGTTCAGCCAGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTACTACGGGGGGTCTAAAAGCTGCA
  800. TGGGCTTTTGCTGGTCCTAAATACGGCAAGAGGTGGACAAAGTATGCTACAACAAAATTGTAGTGCGAAT
  801. GCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATTTAAAGACCCTTTTGAACCCCATTAGAGGCCCATC
  802. AACCCTGATCAGTT
  803.  
  804. >gi|2765594|emb|Z78469.1|PHZ78469 P.haynaldianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  805. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  806. AATCTGGAGGATCAGTTTACTTTAGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  807. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAATTCGTTGCCCGGCGCAGTCTTGCGCCAAGTCATAT
  808. CACACATAATTGGAAGGGGGCGGCATGCGGTCTAGACCCTCCCCAAATTATTTTTTTGACAACTCTCAGC
  809. AACGGATATCTCGGCTCTTCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCC
  810. TTAATGAGGCTGTCCATACATACTGTTCAGCCACAGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACG
  811. GGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTACCTAAATACGGCAAGAGGTGGACGAAGTATGCTACA
  812. ACAAAATGATAGTGCGAATGCCCAGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCCTTTTGA
  813. ACCCCATTAGAGGCCCATCAACCCATGATCAGTT
  814.  
  815. >gi|2765593|emb|Z78468.1|PAZ78468 P.adductum 5.8S rRNA gene and ITS1 and ITS2 DNA
  816. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCGCATAATAATTGATTGAGTT
  817. AATCTGGAGGATCAGTTTACTTTGGTCACTCATGGGAATCTGCTCTTGTAGTGACCTGGATTTGCCATCG
  818. AGCCTCCTTGGGAGCTTTCTTGATGGCGATCTGAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  819. ACACATAATTGGGAGGGGCAGCATGCTGCCTTGACCCTCCCCATATCATTTTTTTAACGACTCTCAGCTC
  820. CGGAACTCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTC
  821. TCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCAGTGCGGATGTGAGTTTGGCCCCTTGTTCTTCGG
  822. TACGGGGGGTCTAAGAGCAGCTGGGCTTTTGATGGACCTAAATACGGCAAGAGGTGGACGAAGTATGCTA
  823. CAACAAAATTATTGTGTGAATGCCCCGGGTTGTCGTATAGATGGGCCAGCATAATCTAAAGACCCTTTTG
  824. AACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTT
  825.  
  826. >gi|2765592|emb|Z78467.1|PSZ78467 P.stonei 5.8S rRNA gene and ITS1 and ITS2 DNA
  827. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  828. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  829. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  830. ACACATAATTGGAAGGGGGTGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTTGACAACTCTCAGCAA
  831. CGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCC
  832. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGTACGCCTGCCTGGGC
  833. ATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTT
  834. GGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGTGCCTTTGGTGGTCCAAAATACGGCAAGA
  835. GGTGGACGAACTATGCTACAACAAAATTGTTGTGCGAATGACCCGGGTTGTCGTATTAGCTGGGCCAGCA
  836. TAATCTAAAGACCCTCTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATATGTTTG
  837. CGACCCAGGTCAGGTGAGGCAACCCGCTGA
  838.  
  839. >gi|2765591|emb|Z78466.1|PPZ78466 P.philippinense 5.8S rRNA gene and ITS1 and ITS2 DNA
  840. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  841. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGTAGTGACCTGGATTTGCCATCG
  842. AGCCTTCATGGGAGCTTTCTTGCTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  843. ACACATAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTGTAACAACTCTCAGCA
  844. ACGGATATCTCGGCTCTTTGCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
  845. CTCTCCCTTAATGAGGCTGTCCATACATACAGTTCAGCCTGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
  846. GCGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
  847. GCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGACCC
  848. TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTGCGACCCAGGTCAGG
  849. TGAGGCAACCC
  850.  
  851. >gi|2765590|emb|Z78465.1|PRZ78465 P.rothschildianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  852. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  853. AATCTGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGCAGTGACCTGGATTTGCCATCG
  854. AGCCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATG
  855. ACACATAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTTTTGACAACTCTCAGCA
  856. ACGGATTTCTCGGTTCTTGAATCGATGAGGAACGCAGCGAAATGCGATAATTGGTGTGAATTGAAGAATC
  857. CCGTAAACCATCGAGTCTTTGAACGAAAGTTGCGCCCGAGGCCATCAGGCCAAGGGAACGCCTGCCTGGG
  858. CATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAGCGAGTGCGGATGTGAGTT
  859. TGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAG
  860. AGGTGGACGAACTATGCTACAACAAAATTGTTGTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGC
  861. ATAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTT
  862. GC
  863.  
  864. >gi|2765589|emb|Z78464.1|PGZ78464 P.glanduliferum 5.8S rRNA gene and ITS1 and ITS2 DNA
  865. CGTAACAAGGTTTCCGTAGGTGAGCGGAAGGGTCATTGTTGAGATCACATAATAATTGATCGGTTGAGTC
  866. TGGAGGATCAGTTTACTTTGGTCACCCATGGGCATCTGCTCTTGTAGTGACCTGGATTGCCATCGAGCCT
  867. CCTTGGGAGCTTTCTTGCTGGAGATCTAAACCCTTGCCCGGAGCAGTTTTGCGCCAAGTCATATGACACA
  868. TAATTGGAAGGGGGCGGCATGCTGCCTTGACCCTCCCCAAATTATTTTCTTAACAACTCTCAGCAACGGA
  869. TATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATCCGATAAATGGTGTGAATTTCAGAATCCCGTG
  870. AACCATCGAGTCTTTGAACGCCAAGTTCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTT
  871. CGAATCAAATCTCTCCCTTAATGAGGCTGTCCAAACATACTGTTCAACCGGTTCGGATGTGAGTTTGGCC
  872. CCTTTTTCTTTGGGGCGGGGGGTCTAAGAACTTCATGGGCTTTTGGTGGTCCTAAAAACGGCAAGAGGTG
  873. GGCGGACTATTCTTCAACCAAATTTCTGTTCGGATTCCCCGGGCTTTCGTAATAGATGGGCCAGCATAAT
  874. CTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTGCGACC
  875. CCAGGTCAGGTGAGCAACCCGCTGAGTTTAAGC
  876.  
  877. >gi|2765588|emb|Z78463.1|PGZ78463 P.glanduliferum 5.8S rRNA gene and ITS1 and ITS2 DNA
  878. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGTTCATTGTTGAGATCACATAATCATTGTTCGGTTG
  879. AGTCTGGAGGATCAGTTTACTTTGGTCACCATGGGCATCTGCTCTTGTAGTGACCTGGATTGCCATCGAG
  880. CCTCCTTGGGAGCTTTCTTGCTGGGGATCTAAACCCTCGCCCGGGGGAGTTTTGCGCCAAGTCATATGAC
  881. ACATAATTGGGAGGGGGCGGCATGTTGCCTTGACCCTCCCCAAATTATTTTCTTAACAACTCTCAGCAAC
  882. GGATATCTCGGCTCTTGCATCGATGGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCC
  883. CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGC
  884. ATTGCGAGTCATATCTCTCCCTTAATGAGGCTGTCCATACATACTGTTCAACCGGTGCGGATGTGAGTTT
  885. GGCCCCTTTTTCTTTGGGGCGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGA
  886. GGTGGACGAACTATGCTGCAACAAAATTGCTGTGCGAATACCCCGGGTTGTCGTATTAGATGGGCCAGCA
  887. TAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGACGGCCATTTGGTTG
  888. CGACCCCAGATCAGGTGAGCAACCCGCTGAGTTTAAGC
  889.  
  890. >gi|2765587|emb|Z78462.1|PSZ78462 P.sukhakulii 5.8S rRNA gene and ITS1 and ITS2 DNA
  891. CGTCACGAGGTCTCCGGATGTGACCCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  892. AATCTGCAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  893. AGCCTCCTTGGGAGATTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  894. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  895. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  896. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  897. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTGCCTGGGCAT
  898. TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGG
  899. CCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGG
  900. TGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTA
  901. ATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCAT
  902.  
  903. >gi|2765586|emb|Z78461.1|PWZ78461 P.wardii 5.8S rRNA gene and ITS1 and ITS2 DNA
  904. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGGT
  905. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCAGTTGCTGCTGGAGTGACCTAGAATTTCCATCG
  906. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTACCCGGCGCAATTTTTCCCCCAGTCAAA
  907. TGACACATAATTGGTGGAGGGGGTGGCATTCTTCCCTGACCCTCCCCCAAATAATTTTTTCACAACTCTC
  908. AGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCACCGAAATCCGATAAATGGTGTGAATTCCAG
  909. AATCCCGTGAACCATCGAGTCTTTGAACCCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGAACGCCTGCC
  910. TGGGCATTGCGAGTCATATCTCTCCCTTAACGAGCCTGTCCATACATCCTGTTCAGCCGGTGCGGATGTG
  911. AGTTTGCCCCCTTGTTCTTTGGTACGGGGGGTCTAAGACCTGCATGGGCTTTTGATGGTCCTAAATACGG
  912. CAAGAGGTGGACGAACTATGCTACACCAAAATTGTTGTCCAAAGCCCCCGGGTTGTCGTATAAGATGGGC
  913. CACCGTAATCTGAAGACCCTTTGAACCCCATTGGAGCCCATCAACCCATGATCAGTTGATGCCATTGTTG
  914. CGACCCAGTCAGTGAGCAAGCCGCTGAGTTAA
  915.  
  916. >gi|2765585|emb|Z78460.1|PCZ78460 P.ciliolare 5.8S rRNA gene and ITS1 and ITS2 DNA
  917. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  918. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  919. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  920. TGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTC
  921. AGCAACGGGATATCTCGGCTCTTGCATCGGATGGAGGAACGCAGCGAAATGCGATAAATGGTGTGAATTG
  922. CAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
  923. GCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGAT
  924. GTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCCAAATA
  925. CGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATG
  926. GGCCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCA
  927. TTTGGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTA
  928.  
  929. >gi|2765584|emb|Z78459.1|PDZ78459 P.dayanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  930. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  931. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  932. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  933. TGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTC
  934. AGCAACGGATATCTCGGCTCTTGCATCGGATGGAGGAACGCAGCGAAATTGCGATAAATTGGTGTGAATT
  935. GCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCC
  936. TGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGA
  937. TGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAAT
  938. ACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGAT
  939. GGGCCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCC
  940. ATTTGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTT
  941.  
  942. >gi|2765583|emb|Z78458.1|PHZ78458 P.hennisianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  943. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  944. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  945. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCGTA
  946. CGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCAAATTATTTTTTAACAACTCTCA
  947. GCAACGGATATCTCGGCTCTTGCATCGATGGAGGACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGA
  948. TCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTG
  949. GGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAG
  950. TTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCA
  951. AGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCA
  952. CCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGG
  953. TTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTG
  954.  
  955. >gi|2765582|emb|Z78457.1|PCZ78457 P.callosum 5.8S rRNA gene and ITS1 and ITS2 DNA
  956. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  957. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTTCTGTTGTAGTGACCTAGAATTTCCATCG
  958. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTTCCCCCAGTCAAA
  959. TGGCACATAATTGGTGGAGGGGGTGGCATTCTTCCCTGACCCTCCCCCAAATATTTTTTTAACAACTCTC
  960. AACAACGGATATCTCGGCTCTTTCATCGGATGAAGGACCGCAGCGAAATGCGATAAATGGTGTGAATTGC
  961. AGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTG
  962. CCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATG
  963. TGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATAC
  964. GGCAAGAGGTGGACGAACTATGCTACAACAAAATCGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGG
  965. GCCACCGTAATCTAAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCAT
  966. TTGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAG
  967.  
  968. >gi|2765581|emb|Z78456.1|PTZ78456 P.tonsum 5.8S rRNA gene and ITS1 and ITS2 DNA
  969. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  970. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTTGCCATC
  971. GAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCAT
  972. ATGACACATAATTGGTGGAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCT
  973. CAGCAACGGATATCTCCGGTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGATTGCAG
  974. AATCCCGTGAACATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCT
  975. GGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGA
  976. GTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGC
  977. AAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCC
  978. ACCGTAATCTGAAGACCCTTTTGGACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTG
  979. GGTTGCGACCCAGGTCAGGTGAGGCAACCCTGAGTTTAGC
  980.  
  981. >gi|2765580|emb|Z78455.1|PJZ78455 P.javanicum 5.8S rRNA gene and ITS1 and ITS2 DNA
  982. CGTAACCAGGTTTCCGTAGGTGGACCTTCGGGAGGATCATTTTTGAGATCACATAAAAATTGATCGAGTT
  983. AATCTGGAGGAACTTTTTACTTTGGTCACCCATGAACAATTTCTTTTGGAGTGACCTAGAATTTCCATCG
  984. AACCCCCTTGGGAACTTTCTTTTTGGCGAGAACTAAACCCTTTCCCGGCGCAGTTTTTCCCCCAATCAAA
  985. TTACACAAAAATGGTGGAGGGGGTGGCATCCTTCCCTTACCCTCCCCCAAATAATTTTTTAACAACTCTC
  986. AGCAACGGATATCTCGGCTCTTGCATCGGTTGAAGAACCAGCGAAATGCGATAAATGGTGTGAATTGCAG
  987. AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCC
  988. TGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTG
  989. AGTTTGGCCCCTTGTTCTTTGGCACGGGGGGTCTAAGAGCTTCATGGGCTTTTGATGGTCCTAAATACGG
  990. CAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGC
  991. CACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTT
  992. GGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAGCA
  993.  
  994. >gi|2765579|emb|Z78454.1|PFZ78454 P.fowliei 5.8S rRNA gene and ITS1 and ITS2 DNA
  995. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGAT
  996. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTACCATCG
  997. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTTCTCCAAGTCATT
  998. TGACACATAATCGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCCCACTATTGTTAACAACTCTCAT
  999. CAACGGAACTCATGCGATAAATGGTGTGATTTGCAGAATCCCGTGAACCATCGAGTCTGTGAACGCAAGT
  1000. TGCGGCCGAGGCCATCAGACCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAG
  1001. GCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTCTGGTACGGGGGGTCT
  1002. AAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTG
  1003. TTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGCCCCTTTTGAACCCATTGG
  1004. AGGCCCATCAACCNCATGATCAGTTGATGGCCATTTGGATGCGACCCCAGGTCAGGTGAGGCAAC
  1005.  
  1006. >gi|2765578|emb|Z78453.1|PSZ78453 P.schoseri 5.8S rRNA gene and ITS1 and ITS2 DNA
  1007. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1008. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAGTTGCCATCG
  1009. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAACTCATT
  1010. TGACACATAACTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAAATTATTTTTTAACAACTCTC
  1011. AGCAACCGGATATCTCAGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCA
  1012. GAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGC
  1013. CTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGT
  1014. GAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACG
  1015. GCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGG
  1016. CCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATT
  1017. TGGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTAGCA
  1018.  
  1019. >gi|2765577|emb|Z78452.1|PBZ78452 P.bougainvilleanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1020. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1021. AATCTGGAGGATCTATTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCA
  1022. AGCCTCCTTGGGAGCTTTCTTTTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  1023. TGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTC
  1024. AGCAACGGATATCTCGGCTCTTGAATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAG
  1025. AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCC
  1026. TGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTG
  1027. AGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGG
  1028. CAAGAGGTGGATGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGC
  1029. CACTGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTT
  1030. GGATGCGACCCCAGGTCAGGTGAGGCAACCGCTGAGTTTAGCA
  1031.  
  1032. >gi|2765576|emb|Z78451.1|PHZ78451 P.hookerae 5.8S rRNA gene and ITS1 and ITS2 DNA
  1033. CGTAACAAGGTTTCCGTAGGTGTACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGAT
  1034. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGTAGTGACCTAGATTTCCATGGA
  1035. GCCCCCCTGGGAGCTTTCTTGCTGGCGAGATCTAAACCCGTGCCCGGCGCAGTTTTGCGCCAAGTCATAT
  1036. GACACATAATTGGTGTAGGGGGCGGGCATCCTGCCCTGACCCTCCCCAAAGTATTTTTTGCAACTCTCAA
  1037. CAACGGAAATCTCGCTCTTTCATCGATGAAGAACCAGCGAAATCGATAAATGGTGTGAATTGCAGAATCC
  1038. CGTGAACCATCGAGTCTTTGAACCCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACCCCTCCCTGGGC
  1039. ATCGCGAGTCAAATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCACCCGGTGCGGATGTGAGTTT
  1040. GCCCCCTTGTTCTTTGGTACGGGGGGTCTAAGACCTGCATGGGATTTTGATGGTCCTAAAAACGGCAAGA
  1041. GGTGGACGAACTATCCCTACAATAAAATTGTTGTGCGAAGCCCCCGGGTTGTCGTATTAGATGGGCCACC
  1042. GTAATCTGAAGACCCTATAGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGATG
  1043. CGACACCAGTCAGTGAGCAACCAGCTGAGC
  1044.  
  1045. >gi|2765575|emb|Z78450.1|PPZ78450 P.papuanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1046. GGAAGGATCATTGCTGATATCACATAATAATTGATCGAGTTAAGCTGGAGGATCTGTTTACTTTGGTCAT
  1047. CCATGAGCATTTACTGTTGAAGTGACCTAGATTTGCCATCGAGCCTCCTTGGGAGCTTTCTTGTTGCCGA
  1048. GATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATATGACACATAATTGGTGAAGGGGGTGGCAT
  1049. CCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGA
  1050. TGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACG
  1051. CAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTCCGAGTCATATCTCTCCCCTA
  1052. ACGAGGCTGTCCATACATACTGTTCATCCGGTGCGGATGTGAGTGTGGCCCCTTGTTCTTTGGTCCGGGG
  1053. GGTCTAAGAACTGCATGGGCATATGATGGTCCTCAAAACTGGCAAGAGGTGGACGAACTATGCTACAACC
  1054. AAATTGTTGTGCCAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAACCTGTAGACCCTGTTGAACC
  1055. CCATTGGAGGACCATCAACCCATGATCAGTTGATGACCATGTGTTGCGACCCCAGATCAGCTGAGCAACC
  1056. CCTGAG
  1057.  
  1058. >gi|2765574|emb|Z78449.1|PMZ78449 P.mastersianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1059. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1060. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  1061. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAACTCATT
  1062. TGACACATAATTGGTGAAGGGTGGCATCCTGCCCTGACCCTCCCCCAAATTATTTTTTTAACAACTCTCA
  1063. GCAACGGATATCTCAGCTCTTGCATCGATGAAGAACGCAGCGAAAATGCGATAAATGGTGTGAATTGCAG
  1064. AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCC
  1065. TGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTG
  1066. AGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGG
  1067. CAAGAGGTGGACGAACTATGCTACAACTAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGC
  1068. CACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTT
  1069. GGTTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGTTTATGC
  1070.  
  1071. >gi|2765573|emb|Z78448.1|PAZ78448 P.argus 5.8S rRNA gene and ITS1 and ITS2 DNA
  1072. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1073. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
  1074. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTTCCCGGCGCAGTTTTGCGCCAAGTCGTA
  1075. TGACACATAATTGGTGAAGGGGGGTGGCATCCTTCCCTTGACCCTCCCCAAATTATTTTTTTAACAACTC
  1076. TCAGCAACGGATATCTCAGCTCTTGCATCGGATGGAAGAACGCACCGAAATGCGATAAATGGTGTGAATT
  1077. GCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCC
  1078. TGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGA
  1079. TGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAAT
  1080. ACGGCAAGAGGTGGACGAACTATGCTACAANAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGAT
  1081. GGGCCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAGCCCATGATCAGTTGATGGCC
  1082. ATTTGGNTGCGACCCCAGGTCAGGTGAGGCAACCCGCTGAGG
  1083.  
  1084. >gi|2765572|emb|Z78447.1|PVZ78447 P.venustum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1085. CGTAACAAGGATTCCGTAGGTGAACCTGCGGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGTA
  1086. ATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTCCTGTTGAAGTGACCTAGAGTTGCCATCGA
  1087. GCCTCCCTGGGAGCTTTCTTGTTGGCGAGAACTAAACCCTTACCCGGCGCAATTTTGCCCCCAGTCAAAT
  1088. GACACATAAGTGGTGAAGGGGGTGGCATCCTATCTCGGCTCTTGCATCGATGAAGAACCCAGCGAAATGC
  1089. GATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAT
  1090. CAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATAC
  1091. TGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGC
  1092. TTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACACCAAAATTGTTGTGCAAAGGCCCC
  1093. GGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCC
  1094. ATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGTCAGGTGAGGCAACCCGCTGAGTTTAAGC
  1095.  
  1096. >gi|2765571|emb|Z78446.1|PAZ78446 P.acmodontum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1097. CGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1098. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTCCTGTTGAAGTGACCTAGATTTGCCATCG
  1099. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCGCCAAGTCATA
  1100. TGACACATAATTGGTGAAGGGGGTGGCATCCTCCCCAAATAATTTTTTAACAACTCTCAGCAACGGATAC
  1101. TCGGCTCTTCATCGATGGAGGACCAGCGAAATTGCGATAATGGTGTGATTGCAGAATCCCGTGAACATCG
  1102. AGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGATTGCGAGTCATA
  1103. TCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCAGATGTGAGTTTGGCCCCTTGTTCT
  1104. TCGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGCCCTAAATACGGCAAGAGGTGGACGAACTA
  1105. TGCTACAACAAAATTGTTGTGCAAAGGCTCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACC
  1106. CTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCAGGTCAG
  1107. GTGAGGCAACCC
  1108.  
  1109. >gi|2765570|emb|Z78445.1|PUZ78445 P.urbanianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1110. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
  1111. AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
  1112. AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
  1113. TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
  1114. AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
  1115. TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
  1116. CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
  1117. TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
  1118. GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
  1119. TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
  1120. GTGAGCAACAGCTGT
  1121.  
  1122. >gi|2765569|emb|Z78444.1|PAZ78444 P.appletonianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1123. CGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1124. AATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  1125. AGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCAATCAAATTACACAAA
  1126. ATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACAACTCTCAGCAACGGA
  1127. TATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTG
  1128. AACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTG
  1129. CGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCC
  1130. CCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTG
  1131. GACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAGATGGGCCACCGATAT
  1132. CTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCCATT
  1133.  
  1134. >gi|2765568|emb|Z78443.1|PLZ78443 P.lawrenceanum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1135. CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTT
  1136. AATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCG
  1137. AGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGCCACANNNNN
  1138. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  1139. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  1140. NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCGAAATGCGATAATGGTGTGAATTGCAGAATCCCGTGA
  1141. ACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGC
  1142. GAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTGGCC
  1143. CCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTG
  1144. GACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCATAAT
  1145. CTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGAC
  1146. CCAGTCAGGTGAGG
  1147.  
  1148. >gi|2765567|emb|Z78442.1|PBZ78442 P.bullenianum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1149. GTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTG
  1150. TTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCGAGCCTCCTTGGGAGC
  1151. TTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCATATGACACATAATTGGT
  1152. GAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTC
  1153. GGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCAT
  1154. CGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGGGAAT
  1155. CATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGATGTGAGTTTGGCCCCTTG
  1156. TTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAACGGCAAGAGGTGGACGA
  1157. ACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAACCTGAA
  1158. GACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCATTTGTTGCGACCCCAGT
  1159. CAGCTGAGCAACCCGCTGAGT
  1160.  
  1161. >gi|2765566|emb|Z78441.1|PSZ78441 P.superbiens 5.8S rRNA gene and ITS1 and ITS2 DNA
  1162. GGAAGGTCATTGCCGATATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCC
  1163. ATGAGCATTTGCTGTTGAAGTGACCTAGATTTGCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGA
  1164. TCTAAACCCTTGCCCGGCGGAGTTGTGCGCCAAGTCATATGACACATAATTGGTGAAGGGGGTGGCATCC
  1165. TGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATG
  1166. AAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCA
  1167. AGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAAC
  1168. GAGGCTGTCCATACATACTGTTCATCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGG
  1169. TCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAA
  1170. TTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCA
  1171. TTGGAGGCCCATCAACCCATGATCAGTTGATGACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCT
  1172. GAG
  1173.  
  1174. >gi|2765565|emb|Z78440.1|PPZ78440 P.purpuratum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1175. CGTAACAAGGTTTCCGTAGGTGGACCTCCGGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGT
  1176. AATCTGGAGGATCTGCATATTTTGGTCACCCATGGGCAATTTCTGTTGTAGTGACCTAGAATTTCCATCG
  1177. ACCCTCCTTGGGAGCATTCTTGTTGGCGAGAACTAAACCCTTACCCGGCGCAGTTTTTCCCCCAATCAAA
  1178. TTACACAAAAATGGTGGAGGGGGTGGCATATCTTCCCTTACCCTCCCCCAAATAATTTTTTAACAACTCT
  1179. CAGCAACGGATATCTCAGCTCTTGCATCGTTGAAGAACCCACCGAAATGCGATAAATGGTGTGAATTGCA
  1180. GAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGC
  1181. CTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGT
  1182. GAGTTTGGCCCCTTGTTCTTTGCTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACG
  1183. GCAAGAGGTGGACGAACTATGCTACAGCAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGG
  1184. CCACCGTAATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATT
  1185. TGGTTGCGACCCCAGGTCAGGTGAGGCAACCCCTGAGTTTAGCA
  1186.  
  1187. >gi|2765564|emb|Z78439.1|PBZ78439 P.barbatum 5.8S rRNA gene and ITS1 and ITS2 DNA
  1188. CATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGC
  1189. ATTTGCTGTTGAAGTGACCTAGATTTGCCATCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAA
  1190. CCCCTGCCCGGCGGAGTTGGGCGCCAAGTCATATGACACATAATTGGTGAAGGGGGTGGTAATCCTGCCC
  1191. TGACCCTCCCCAAATTATTTTTTTAACAACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAA
  1192. CGCAGCGAAATGCGATAATGGTGTGAATTGCAGAATCCCGTGAACATCGAGTCTTTGAACGCAAGTTGCG
  1193. CCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAATGAGGCTG
  1194. TCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGA
  1195. GCTGCATGGGCTTTGGATGGTCCTAAATACGGAAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGT
  1196. GCAAATGCCCCGGTTGGCCGTTTAGTTGGGCC

Télécharger